Incidental Mutation 'R4663:Fam196a'
ID500767
Institutional Source Beutler Lab
Gene Symbol Fam196a
Ensembl Gene ENSMUSG00000073805
Gene Namefamily with sequence similarity 196, member A
Synonyms
MMRRC Submission 041921-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4663 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location134881926-134938430 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 134899148 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 409 (Y409*)
Ref Sequence ENSEMBL: ENSMUSP00000129222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084488] [ENSMUST00000171394]
Predicted Effect probably benign
Transcript: ENSMUST00000084488
SMART Domains Protein: ENSMUSP00000081531
Gene: ENSMUSG00000058325

DomainStartEndE-ValueType
SH3 12 69 7.57e-17 SMART
Pfam:DOCK_N 72 416 1.7e-113 PFAM
Pfam:DOCK-C2 421 618 1.2e-61 PFAM
low complexity region 628 639 N/A INTRINSIC
Pfam:DHR-2 1111 1610 3.3e-102 PFAM
low complexity region 1639 1664 N/A INTRINSIC
low complexity region 1683 1701 N/A INTRINSIC
low complexity region 1756 1773 N/A INTRINSIC
low complexity region 1823 1857 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171394
AA Change: Y409*
SMART Domains Protein: ENSMUSP00000129222
Gene: ENSMUSG00000073805
AA Change: Y409*

DomainStartEndE-ValueType
Pfam:FAM196 1 470 4.7e-205 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210617
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype Mice homozygous for a null allele exhibit postnatal lethality associated with abnormal muscle development and failure of lungs to inflate.,NO_PHENOTYPE
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,455 V1496A probably benign Het
Aqr A T 2: 114,161,666 Y76* probably null Het
Armc5 C A 7: 128,238,545 A140E probably benign Het
Auts2 T C 5: 131,439,638 H947R probably damaging Het
Bag2 T C 1: 33,746,993 T83A probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 A G 8: 104,211,167 Y126C probably damaging Het
Cars T C 7: 143,575,960 E330G probably damaging Het
Ccdc40 A G 11: 119,231,506 I45V probably benign Het
Cd320 G A 17: 33,848,178 G214R probably null Het
Ckm G A 7: 19,419,494 V237M probably damaging Het
Cspg4 T C 9: 56,886,676 V565A possibly damaging Het
Ephb6 A G 6: 41,617,865 Y638C probably damaging Het
Epp13 T G 7: 6,258,625 I35S possibly damaging Het
Fat2 G C 11: 55,296,213 S1269* probably null Het
Fbxo3 T C 2: 104,053,475 V348A probably damaging Het
Gas6 G A 8: 13,470,254 P478L probably damaging Het
Gm11492 T A 11: 87,567,603 Y268N probably damaging Het
Herc1 T C 9: 66,433,378 S1670P probably damaging Het
Hnrnpk C A 13: 58,394,517 R281L probably damaging Het
Ifih1 C A 2: 62,609,219 C488F probably benign Het
Ift172 T C 5: 31,284,215 K192E probably benign Het
Ighv5-9 T A 12: 113,661,820 Q101L probably benign Het
Igkv3-2 G T 6: 70,698,879 M57I probably benign Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
L3mbtl3 T C 10: 26,337,817 Y237C unknown Het
Lats1 G A 10: 7,712,583 C988Y probably damaging Het
Lgals3 T A 14: 47,381,622 probably null Het
Lrrc3b G T 14: 15,358,220 H129N probably benign Het
Lrriq1 T C 10: 103,063,412 H1656R possibly damaging Het
Lypd6 T G 2: 50,173,611 Y43* probably null Het
Mfsd7a T C 5: 108,442,145 M464V probably benign Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Msi1 G A 5: 115,450,275 R284Q probably damaging Het
Mybpc2 T C 7: 44,505,642 E947G probably damaging Het
Nat14 T A 7: 4,924,447 L206Q probably damaging Het
Nup88 A T 11: 70,965,846 probably null Het
Olfr27 A T 9: 39,144,849 I250F probably damaging Het
Olfr727 A G 14: 50,127,482 R302G probably benign Het
Olfr743 A T 14: 50,533,604 Y64F probably damaging Het
Pdcl T C 2: 37,355,766 E75G probably damaging Het
Phf14 A G 6: 11,953,422 I387V possibly damaging Het
Phf3 G A 1: 30,821,215 R845W probably damaging Het
Pm20d1 T C 1: 131,798,602 I59T probably damaging Het
Prkd1 C T 12: 50,419,848 probably null Het
Psmb2 T C 4: 126,677,765 L4P probably damaging Het
Pttg1 T A 11: 43,424,850 K46* probably null Het
Rrnad1 A G 3: 87,927,748 S82P probably damaging Het
Ryr2 T C 13: 11,749,509 H1401R possibly damaging Het
Sh3d19 G A 3: 86,123,263 D696N probably benign Het
Slc16a2 T C X: 103,707,979 T274A probably benign Het
Slc26a6 G A 9: 108,857,907 A335T probably damaging Het
Slc6a5 C A 7: 49,938,398 Y493* probably null Het
Slf1 A T 13: 77,126,604 S37R probably damaging Het
Smoc1 G A 12: 81,167,602 G264S probably damaging Het
Snapc4 T C 2: 26,374,181 E280G possibly damaging Het
Snx25 G A 8: 46,035,579 T913M probably damaging Het
Snx7 T C 3: 117,800,879 T408A probably benign Het
Spdya T A 17: 71,578,344 S264R probably benign Het
Spg11 A T 2: 122,098,099 probably null Het
Suz12 T A 11: 80,013,524 L230Q probably damaging Het
Szt2 A G 4: 118,377,684 probably benign Het
Tenm3 C A 8: 48,235,970 R2194L probably damaging Het
Tmed8 T A 12: 87,174,231 I194F probably damaging Het
Tmem79 T A 3: 88,333,444 T66S probably damaging Het
Trappc1 T A 11: 69,325,511 S118T probably benign Het
Ttn C T 2: 76,738,881 V27223I probably benign Het
Ttn T C 2: 76,776,495 T18024A probably damaging Het
Vmn2r15 C T 5: 109,294,074 M164I probably benign Het
Vmn2r53 T A 7: 12,600,974 Y253F probably benign Het
Wdr92 T C 11: 17,232,853 V338A probably benign Het
Zfand6 C T 7: 84,617,885 R163H probably benign Het
Other mutations in Fam196a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01504:Fam196a APN 7 134917940 missense probably benign 0.15
IGL02380:Fam196a APN 7 134899144 critical splice donor site probably null
R0557:Fam196a UTSW 7 134918705 missense probably damaging 1.00
R1421:Fam196a UTSW 7 134899231 splice site probably benign
R1691:Fam196a UTSW 7 134918286 missense probably damaging 1.00
R1726:Fam196a UTSW 7 134899138 splice site probably benign
R2045:Fam196a UTSW 7 134918430 missense probably damaging 1.00
R2259:Fam196a UTSW 7 134917667 missense probably damaging 1.00
R3078:Fam196a UTSW 7 134918021 missense probably benign 0.15
R3851:Fam196a UTSW 7 134884526 missense probably benign 0.23
R4619:Fam196a UTSW 7 134918541 missense probably damaging 1.00
R5024:Fam196a UTSW 7 134918478 missense probably damaging 1.00
R5067:Fam196a UTSW 7 134918555 missense probably benign 0.01
R5195:Fam196a UTSW 7 134884416 missense probably damaging 1.00
R5708:Fam196a UTSW 7 134918796 missense probably damaging 1.00
R6195:Fam196a UTSW 7 134918648 missense probably damaging 1.00
R7151:Fam196a UTSW 7 134918645 missense probably damaging 1.00
R7414:Fam196a UTSW 7 134918009 missense probably benign 0.06
Z1176:Fam196a UTSW 7 134918706 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCTGGGGTTGTATACCTGG -3'
(R):5'- CAAGCATCTCATACCGGGAAG -3'

Sequencing Primer
(F):5'- TGGATGGAAGGATGGCTGTTTAGAC -3'
(R):5'- ATCTCATACCGGGAAGGCGTC -3'
Posted On2017-12-01