Mutagenetix > Incidental Mutations

Incidental Mutation 'R4663:Lrriq1'

353025

Institutional Source

Beutler Lab

Gene Symbol

Lrriq1

Ensembl Gene

ENSMUSG00000019892

Gene Name

leucine-rich repeats and IQ motif containing 1

Synonyms

LOC380658, 4930503E15Rik, Gm1557

MMRRC Submission

041921-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R4663 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

103046031-103236322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103063412 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1656 (H1656R)

Ref Sequence

ENSEMBL: ENSMUSP00000131419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166240]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166240
AA Change: H1656R

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131419
Gene: ENSMUSG00000019892
AA Change: H1656R

Domain	Start	End	E-Value	Type
coiled coil region	11	31	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
coiled coil region	183	286	N/A	INTRINSIC
IQ	290	312	9.78e1	SMART
coiled coil region	314	390	N/A	INTRINSIC
low complexity region	550	559	N/A	INTRINSIC
LRR	873	894	2.14e1	SMART
LRR	895	917	4.45e1	SMART
LRR	984	1005	2.03e2	SMART
LRR	1029	1052	3.65e0	SMART
low complexity region	1244	1258	N/A	INTRINSIC
IQ	1279	1301	5.61e1	SMART
IQ	1339	1361	6.7e-3	SMART
low complexity region	1369	1394	N/A	INTRINSIC
low complexity region	1502	1518	N/A	INTRINSIC
low complexity region	1528	1543	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000218841
AA Change: H103R

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,218,455	V1496A	probably benign	Het
Aqr	A	T	2: 114,161,666	Y76*	probably null	Het
Armc5	C	A	7: 128,238,545	A140E	probably benign	Het
Auts2	T	C	5: 131,439,638	H947R	probably damaging	Het
Bag2	T	C	1: 33,746,993	T83A	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Bean1	A	G	8: 104,211,167	Y126C	probably damaging	Het
Cars	T	C	7: 143,575,960	E330G	probably damaging	Het
Ccdc40	A	G	11: 119,231,506	I45V	probably benign	Het
Cd320	G	A	17: 33,848,178	G214R	probably null	Het
Ckm	G	A	7: 19,419,494	V237M	probably damaging	Het
Cspg4	T	C	9: 56,886,676	V565A	possibly damaging	Het
Ephb6	A	G	6: 41,617,865	Y638C	probably damaging	Het
Epp13	T	G	7: 6,258,625	I35S	possibly damaging	Het
Fam196a	A	T	7: 134,899,148	Y409*	probably null	Het
Fat2	G	C	11: 55,296,213	S1269*	probably null	Het
Fbxo3	T	C	2: 104,053,475	V348A	probably damaging	Het
Gas6	G	A	8: 13,470,254	P478L	probably damaging	Het
Gm11492	T	A	11: 87,567,603	Y268N	probably damaging	Het
Herc1	T	C	9: 66,433,378	S1670P	probably damaging	Het
Hnrnpk	C	A	13: 58,394,517	R281L	probably damaging	Het
Ifih1	C	A	2: 62,609,219	C488F	probably benign	Het
Ift172	T	C	5: 31,284,215	K192E	probably benign	Het
Ighv5-9	T	A	12: 113,661,820	Q101L	probably benign	Het
Igkv3-2	G	T	6: 70,698,879	M57I	probably benign	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
L3mbtl3	T	C	10: 26,337,817	Y237C	unknown	Het
Lats1	G	A	10: 7,712,583	C988Y	probably damaging	Het
Lgals3	T	A	14: 47,381,622		probably null	Het
Lrrc3b	G	T	14: 15,358,220	H129N	probably benign	Het
Lypd6	T	G	2: 50,173,611	Y43*	probably null	Het
Mfsd7a	T	C	5: 108,442,145	M464V	probably benign	Het
Mical2	A	G	7: 112,328,677	D674G	possibly damaging	Het
Msi1	G	A	5: 115,450,275	R284Q	probably damaging	Het
Mybpc2	T	C	7: 44,505,642	E947G	probably damaging	Het
Nat14	T	A	7: 4,924,447	L206Q	probably damaging	Het
Nup88	A	T	11: 70,965,846		probably null	Het
Olfr27	A	T	9: 39,144,849	I250F	probably damaging	Het
Olfr727	A	G	14: 50,127,482	R302G	probably benign	Het
Olfr743	A	T	14: 50,533,604	Y64F	probably damaging	Het
Pdcl	T	C	2: 37,355,766	E75G	probably damaging	Het
Phf14	A	G	6: 11,953,422	I387V	possibly damaging	Het
Phf3	G	A	1: 30,821,215	R845W	probably damaging	Het
Pm20d1	T	C	1: 131,798,602	I59T	probably damaging	Het
Prkd1	C	T	12: 50,419,848		probably null	Het
Psmb2	T	C	4: 126,677,765	L4P	probably damaging	Het
Pttg1	T	A	11: 43,424,850	K46*	probably null	Het
Rrnad1	A	G	3: 87,927,748	S82P	probably damaging	Het
Ryr2	T	C	13: 11,749,509	H1401R	possibly damaging	Het
Sh3d19	G	A	3: 86,123,263	D696N	probably benign	Het
Slc16a2	T	C	X: 103,707,979	T274A	probably benign	Het
Slc26a6	G	A	9: 108,857,907	A335T	probably damaging	Het
Slc6a5	C	A	7: 49,938,398	Y493*	probably null	Het
Slf1	A	T	13: 77,126,604	S37R	probably damaging	Het
Smoc1	G	A	12: 81,167,602	G264S	probably damaging	Het
Snapc4	T	C	2: 26,374,181	E280G	possibly damaging	Het
Snx25	G	A	8: 46,035,579	T913M	probably damaging	Het
Snx7	T	C	3: 117,800,879	T408A	probably benign	Het
Spdya	T	A	17: 71,578,344	S264R	probably benign	Het
Spg11	A	T	2: 122,098,099		probably null	Het
Suz12	T	A	11: 80,013,524	L230Q	probably damaging	Het
Szt2	A	G	4: 118,377,684		probably benign	Het
Tenm3	C	A	8: 48,235,970	R2194L	probably damaging	Het
Tmed8	T	A	12: 87,174,231	I194F	probably damaging	Het
Tmem79	T	A	3: 88,333,444	T66S	probably damaging	Het
Trappc1	T	A	11: 69,325,511	S118T	probably benign	Het
Ttn	C	T	2: 76,738,881	V27223I	probably benign	Het
Ttn	T	C	2: 76,776,495	T18024A	probably damaging	Het
Vmn2r15	C	T	5: 109,294,074	M164I	probably benign	Het
Vmn2r53	T	A	7: 12,600,974	Y253F	probably benign	Het
Wdr92	T	C	11: 17,232,853	V338A	probably benign	Het
Zfand6	C	T	7: 84,617,885	R163H	probably benign	Het

Other mutations in Lrriq1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Lrriq1	APN	10	103161896	missense	probably damaging	0.99
IGL01523:Lrriq1	APN	10	103218116	nonsense	probably null
IGL01637:Lrriq1	APN	10	103215628	missense	probably benign
IGL02019:Lrriq1	APN	10	103178800	missense	probably benign	0.02
IGL02153:Lrriq1	APN	10	103170479	missense	probably benign	0.01
IGL02341:Lrriq1	APN	10	103224941	missense	probably benign	0.03
IGL02343:Lrriq1	APN	10	103234163	splice site	probably benign
IGL02408:Lrriq1	APN	10	103146281	missense	probably benign	0.17
IGL02431:Lrriq1	APN	10	103200639	missense	probably damaging	1.00
IGL02540:Lrriq1	APN	10	103215019	missense	probably benign	0.02
IGL02558:Lrriq1	APN	10	103146283	missense	probably damaging	1.00
IGL02613:Lrriq1	APN	10	103144548	missense	probably damaging	0.99
IGL02642:Lrriq1	APN	10	103221461	critical splice acceptor site	probably null
IGL03027:Lrriq1	APN	10	103227196	missense	probably benign	0.35
PIT4362001:Lrriq1	UTSW	10	103071194	missense	probably benign	0.26
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0050:Lrriq1	UTSW	10	103068931	missense	probably damaging	0.99
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0068:Lrriq1	UTSW	10	103063418	missense	probably benign	0.02
R0124:Lrriq1	UTSW	10	103170420	critical splice donor site	probably null
R0244:Lrriq1	UTSW	10	103215773	missense	probably damaging	0.98
R0323:Lrriq1	UTSW	10	103221289	missense	possibly damaging	0.91
R0515:Lrriq1	UTSW	10	103068968	splice site	probably null
R0522:Lrriq1	UTSW	10	103161777	missense	probably damaging	0.99
R0701:Lrriq1	UTSW	10	103234044	missense	probably benign
R1220:Lrriq1	UTSW	10	103071129	missense	probably benign	0.05
R1261:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1262:Lrriq1	UTSW	10	103234137	missense	possibly damaging	0.87
R1451:Lrriq1	UTSW	10	103202515	splice site	probably benign
R1642:Lrriq1	UTSW	10	103214456	missense	probably benign	0.13
R1643:Lrriq1	UTSW	10	103214824	missense	probably benign	0.00
R1647:Lrriq1	UTSW	10	103170648	nonsense	probably null
R1830:Lrriq1	UTSW	10	103161759	missense	probably benign
R1843:Lrriq1	UTSW	10	103227173	splice site	probably null
R2128:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2129:Lrriq1	UTSW	10	103214857	missense	probably benign	0.01
R2199:Lrriq1	UTSW	10	103068913	missense	probably damaging	1.00
R2354:Lrriq1	UTSW	10	103189987	missense	probably damaging	1.00
R2495:Lrriq1	UTSW	10	103202381	missense	probably damaging	0.97
R2897:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2898:Lrriq1	UTSW	10	103227250	missense	probably damaging	0.99
R2922:Lrriq1	UTSW	10	103214675	missense	probably benign	0.00
R2939:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R2965:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R2966:Lrriq1	UTSW	10	103214900	missense	probably benign	0.07
R3081:Lrriq1	UTSW	10	103144889	missense	probably damaging	0.98
R3115:Lrriq1	UTSW	10	103170433	missense	probably benign	0.00
R3745:Lrriq1	UTSW	10	103170856	missense	probably damaging	0.99
R3813:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3814:Lrriq1	UTSW	10	103216111	missense	probably damaging	1.00
R3885:Lrriq1	UTSW	10	103216106	missense	probably damaging	0.96
R4378:Lrriq1	UTSW	10	103202364	missense	probably damaging	1.00
R4632:Lrriq1	UTSW	10	103221427	missense	probably damaging	1.00
R4633:Lrriq1	UTSW	10	103200563	nonsense	probably null
R4702:Lrriq1	UTSW	10	103215749	missense	possibly damaging	0.65
R4793:Lrriq1	UTSW	10	103170466	missense	probably benign	0.25
R4801:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4802:Lrriq1	UTSW	10	103221318	missense	probably benign	0.02
R4815:Lrriq1	UTSW	10	103144878	missense	probably benign	0.10
R4872:Lrriq1	UTSW	10	103178788	missense	possibly damaging	0.56
R4877:Lrriq1	UTSW	10	103234038	missense	possibly damaging	0.88
R4894:Lrriq1	UTSW	10	103161752	missense	possibly damaging	0.86
R4990:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R4991:Lrriq1	UTSW	10	103200559	missense	probably damaging	1.00
R5011:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5013:Lrriq1	UTSW	10	103189923	missense	probably damaging	1.00
R5122:Lrriq1	UTSW	10	103187453	missense	probably damaging	1.00
R5282:Lrriq1	UTSW	10	103215345	missense	probably benign	0.01
R5311:Lrriq1	UTSW	10	103214587	missense	probably damaging	1.00
R5567:Lrriq1	UTSW	10	103170596	missense	possibly damaging	0.56
R5643:Lrriq1	UTSW	10	103215440	missense	probably benign	0.00
R5683:Lrriq1	UTSW	10	103173375	missense	probably damaging	1.00
R5916:Lrriq1	UTSW	10	103221382	nonsense	probably null
R6008:Lrriq1	UTSW	10	103170464	missense	probably damaging	1.00
R6022:Lrriq1	UTSW	10	103215534	missense	possibly damaging	0.90
R6224:Lrriq1	UTSW	10	103215757	missense	probably damaging	1.00
R6254:Lrriq1	UTSW	10	103215451	missense	probably benign	0.15
R6311:Lrriq1	UTSW	10	103173393	missense	probably benign	0.03
R6460:Lrriq1	UTSW	10	103200698	missense	probably damaging	1.00
R6502:Lrriq1	UTSW	10	103227184	missense	probably damaging	0.99
R6637:Lrriq1	UTSW	10	103221432	missense	probably benign	0.06
R6719:Lrriq1	UTSW	10	103071116	missense	probably damaging	1.00
R6736:Lrriq1	UTSW	10	103181889	critical splice acceptor site	probably null
R6928:Lrriq1	UTSW	10	103214939	missense	possibly damaging	0.95
R6991:Lrriq1	UTSW	10	103187458	missense	probably damaging	1.00
R7174:Lrriq1	UTSW	10	103224965	missense	probably benign
R7241:Lrriq1	UTSW	10	103215973	missense	probably damaging	1.00
R7248:Lrriq1	UTSW	10	103223750	missense	possibly damaging	0.85
R7287:Lrriq1	UTSW	10	103216016	missense	probably benign	0.00
R7402:Lrriq1	UTSW	10	103221324	missense	possibly damaging	0.87
R7439:Lrriq1	UTSW	10	103214519	missense	probably benign	0.21
R7585:Lrriq1	UTSW	10	103214946	missense	possibly damaging	0.93
R7611:Lrriq1	UTSW	10	103200571	missense	possibly damaging	0.54
R7634:Lrriq1	UTSW	10	103200601	missense	probably damaging	1.00
R7767:Lrriq1	UTSW	10	103215954	missense	probably damaging	0.99
R7809:Lrriq1	UTSW	10	103215817	missense	probably damaging	0.99
R7910:Lrriq1	UTSW	10	103215194	nonsense	probably null
R7991:Lrriq1	UTSW	10	103215194	nonsense	probably null
R8131:Lrriq1	UTSW	10	103215711	missense	possibly damaging	0.57
R8156:Lrriq1	UTSW	10	103156335	critical splice donor site	probably null
X0026:Lrriq1	UTSW	10	103215704	nonsense	probably null
Z1088:Lrriq1	UTSW	10	103202446	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202359	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103202360	missense	probably damaging	1.00
Z1176:Lrriq1	UTSW	10	103234085	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGAGGAGTGAAGCAGCTTC -3'
(R):5'- GGTAATGTGAGCCGCATTCAG -3'

Sequencing Primer
(F):5'- ACACTGATGCTGTTACATTTACAAG -3'
(R):5'- TGTGAGCCGCATTCAGAAAATG -3'

Posted On

2015-10-08