Incidental Mutation 'R6193:Olfr392'
ID502734
Institutional Source Beutler Lab
Gene Symbol Olfr392
Ensembl Gene ENSMUSG00000061984
Gene Nameolfactory receptor 392
SynonymsGA_x6K02T2P1NL-3966976-3966038, MOR135-9
MMRRC Submission 044333-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6193 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73811740-73817049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73814824 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 86 (H86L)
Ref Sequence ENSEMBL: ENSMUSP00000123649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118463] [ENSMUST00000144724]
Predicted Effect probably benign
Transcript: ENSMUST00000118463
AA Change: H86L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113118
Gene: ENSMUSG00000061984
AA Change: H86L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.6e-6 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144724
AA Change: H86L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123649
Gene: ENSMUSG00000061984
AA Change: H86L

DomainStartEndE-ValueType
Pfam:7tm_1 41 116 2e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg A G 15: 60,920,780 I106T probably benign Het
Aagab A C 9: 63,617,513 N35H possibly damaging Het
Abcf1 A C 17: 35,963,572 N161K possibly damaging Het
Adam11 T A 11: 102,771,261 H140Q probably benign Het
Araf G T X: 20,860,100 R601L probably damaging Homo
Arhgef26 A T 3: 62,339,792 D99V possibly damaging Het
Arhgef28 A G 13: 97,985,380 S559P probably damaging Het
C130060K24Rik T A 6: 65,456,158 F321I probably damaging Het
Capn11 A G 17: 45,653,504 probably null Het
Ccdc157 T C 11: 4,151,912 H3R probably damaging Het
Cd101 A G 3: 101,020,462 L101P probably damaging Het
Clca3a1 A G 3: 144,759,232 V80A possibly damaging Het
Cnot6 T A 11: 49,680,023 I381F probably benign Het
Cntn3 T A 6: 102,208,131 I675F probably benign Het
Cplx2 C T 13: 54,379,593 P97S probably damaging Het
Crtac1 T A 19: 42,323,797 E159V possibly damaging Het
Cyp27a1 A G 1: 74,737,072 I416V probably benign Het
Cyp2d37-ps T C 15: 82,689,813 noncoding transcript Het
Cyp2d9 A G 15: 82,452,527 T26A probably benign Het
Cyp2j7 T A 4: 96,195,203 R503S probably damaging Het
Dclk1 A T 3: 55,516,871 probably null Het
Dgkq A T 5: 108,655,500 C231* probably null Het
Dync1i1 T A 6: 5,730,679 M38K probably benign Het
Eif2ak4 C T 2: 118,400,600 probably benign Het
Ephx2 A T 14: 66,089,512 D411E probably benign Het
Ephx2 T G 14: 66,112,220 Q34P probably benign Het
Fam192a A G 8: 94,575,720 S228P probably damaging Het
Fer1l5 A T 1: 36,409,436 N1092Y probably benign Het
Fetub C T 16: 22,932,331 R143C probably damaging Het
Fzd4 A T 7: 89,407,989 K415* probably null Het
Gfi1 A T 5: 107,721,531 Y278N probably benign Het
Gm11565 T C 11: 99,915,244 M154T probably benign Het
Gm14548 C G 7: 3,898,050 probably null Het
Gm7247 A G 14: 51,521,842 I93V possibly damaging Het
Golm1 T G 13: 59,645,158 I178L probably benign Het
Grip1 A T 10: 120,038,314 D302V probably damaging Het
Gtf2h1 G A 7: 46,806,830 probably null Het
Herc2 C A 7: 56,156,901 P2372T probably damaging Het
Ighv1-59 C A 12: 115,335,166 L89F probably damaging Het
Ighv7-4 G A 12: 114,222,825 A109V possibly damaging Het
Kcnk10 G T 12: 98,440,772 Q222K probably benign Het
Klra6 A T 6: 130,018,918 M159K probably benign Het
Lzts3 T C 2: 130,637,386 T36A probably damaging Het
Mgam T A 6: 40,747,920 Y443* probably null Het
Mmp23 T A 4: 155,651,533 M221L possibly damaging Het
Mmp7 T A 9: 7,695,518 V132E probably damaging Het
Npas2 C A 1: 39,292,762 T86N probably damaging Het
Olfr1043 C T 2: 86,162,284 V222M possibly damaging Het
Papola A T 12: 105,820,346 E103V probably benign Het
Parp9 A T 16: 35,947,551 N34Y possibly damaging Het
Pcdh7 A G 5: 57,720,324 D407G probably damaging Het
Pcdhb5 T G 18: 37,322,027 Y487D probably damaging Het
Pla2g4a T C 1: 149,902,430 D5G probably damaging Het
Plxnb1 T C 9: 109,104,903 L733P probably benign Het
Ppfia4 T C 1: 134,324,161 D425G probably benign Het
Prss2 T G 6: 41,521,820 I6S unknown Het
Qrich2 T A 11: 116,454,153 I1693L probably benign Het
Rad52 T C 6: 119,920,182 V324A probably benign Het
Rapgef2 A T 3: 79,069,444 Y1352N possibly damaging Het
Rsad2 T G 12: 26,456,187 Y78S probably damaging Het
Scaf1 A G 7: 45,006,780 probably benign Het
Sfxn5 T C 6: 85,269,936 T131A probably damaging Het
Slc4a10 T G 2: 62,243,357 probably null Het
Syt1 A G 10: 108,500,736 V357A probably benign Het
Tenm2 T A 11: 36,046,794 D1685V probably damaging Het
Thegl A G 5: 77,016,336 D62G possibly damaging Het
Tmc3 A G 7: 83,603,335 T315A probably benign Het
Tmem266 T C 9: 55,437,209 L375P probably benign Het
Tsks T G 7: 44,953,839 L355R probably damaging Het
Uaca G A 9: 60,870,044 R571Q probably damaging Het
Ube2f T A 1: 91,275,319 probably null Het
Usp37 A T 1: 74,492,928 V102D probably damaging Het
Usp44 G A 10: 93,847,148 probably benign Het
Vmn2r115 T C 17: 23,357,009 F527S probably benign Het
Zfp101 A C 17: 33,381,746 Y345* probably null Het
Zfp160 C A 17: 21,026,862 A558E probably benign Het
Zfp236 T C 18: 82,604,247 E1686G probably damaging Het
Zfp655 T A 5: 145,244,776 D481E probably benign Het
Zswim4 A G 8: 84,226,145 V396A probably benign Het
Other mutations in Olfr392
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Olfr392 APN 11 73814786 missense probably damaging 0.97
IGL02976:Olfr392 APN 11 73814317 missense probably damaging 0.98
IGL03344:Olfr392 APN 11 73814177 missense probably benign 0.21
R0196:Olfr392 UTSW 11 73814905 missense probably damaging 0.99
R0347:Olfr392 UTSW 11 73814311 missense probably damaging 0.98
R0594:Olfr392 UTSW 11 73814617 missense probably benign 0.12
R0940:Olfr392 UTSW 11 73814224 missense probably damaging 1.00
R1233:Olfr392 UTSW 11 73814350 missense probably damaging 1.00
R1300:Olfr392 UTSW 11 73814246 missense probably benign 0.13
R1490:Olfr392 UTSW 11 73814371 missense possibly damaging 0.95
R3111:Olfr392 UTSW 11 73814186 missense probably benign
R4827:Olfr392 UTSW 11 73814721 nonsense probably null
R4852:Olfr392 UTSW 11 73814248 missense probably benign 0.11
R4992:Olfr392 UTSW 11 73814320 missense probably damaging 1.00
R7201:Olfr392 UTSW 11 73814341 missense probably benign 0.19
R7310:Olfr392 UTSW 11 73814286 missense probably damaging 0.98
X0021:Olfr392 UTSW 11 73814305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCATGGAATATAGTCAACATC -3'
(R):5'- AGCTGTTGTTCAATGCCCTG -3'

Sequencing Primer
(F):5'- TAGCACTAGTGAAACACAGAGCTTG -3'
(R):5'- GTTCAATGCCCTGTTCTTGG -3'
Posted On2018-02-27