Incidental Mutation 'R4852:Olfr392'
ID373647
Institutional Source Beutler Lab
Gene Symbol Olfr392
Ensembl Gene ENSMUSG00000061984
Gene Nameolfactory receptor 392
SynonymsGA_x6K02T2P1NL-3966976-3966038, MOR135-9
MMRRC Submission 042464-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4852 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73811740-73817049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73814248 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 278 (Y278C)
Ref Sequence ENSEMBL: ENSMUSP00000123649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118463] [ENSMUST00000144724]
Predicted Effect probably benign
Transcript: ENSMUST00000118463
AA Change: Y278C

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113118
Gene: ENSMUSG00000061984
AA Change: Y278C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.6e-6 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144724
AA Change: Y278C

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123649
Gene: ENSMUSG00000061984
AA Change: Y278C

DomainStartEndE-ValueType
Pfam:7tm_1 41 116 2e-12 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921524L21Rik C G 18: 6,623,487 L66V possibly damaging Het
4921524L21Rik T A 18: 6,623,488 L66Q probably damaging Het
Abca6 A G 11: 110,244,203 V252A probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acap1 C T 11: 69,884,376 V354M probably benign Het
Accs T C 2: 93,844,260 D99G probably damaging Het
Adam9 T C 8: 25,003,301 Y97C probably damaging Het
Akap6 T C 12: 53,104,675 V1174A probably damaging Het
Aknad1 C A 3: 108,751,740 D23E probably damaging Het
Ano2 T C 6: 125,982,923 C666R possibly damaging Het
Atp4a G A 7: 30,724,268 A933T probably benign Het
Atxn2 T C 5: 121,814,411 L224P probably damaging Het
Bin2 T C 15: 100,645,288 E338G probably damaging Het
Bloc1s5 T C 13: 38,634,984 K20E probably damaging Het
Bst1 A T 5: 43,820,525 D72V probably benign Het
Cacna1i T C 15: 80,388,479 F1631L probably damaging Het
Capn13 GCA G 17: 73,351,506 probably null Het
Cfap43 A G 19: 47,897,111 I355T possibly damaging Het
Chuk A T 19: 44,088,758 M383K possibly damaging Het
Cnga4 A G 7: 105,405,730 I174V probably benign Het
Cpd T C 11: 76,785,150 K1226E probably benign Het
Crip2 T C 12: 113,140,584 C5R probably damaging Het
Cyp3a11 T A 5: 145,860,495 D358V probably damaging Het
Ebag9 T C 15: 44,624,519 F21S probably damaging Het
Ercc1 A T 7: 19,350,704 H70L probably damaging Het
Exoc3 G A 13: 74,199,645 R69C probably damaging Het
Fgfr4 A T 13: 55,161,156 R363S possibly damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm7489 T A 15: 53,886,038 probably benign Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Gpr152 G A 19: 4,143,791 V444I probably benign Het
Gss T C 2: 155,564,865 E330G probably benign Het
Hbs1l A G 10: 21,358,388 D556G possibly damaging Het
Helz2 T C 2: 181,230,120 T2619A probably damaging Het
Hk3 A G 13: 55,012,596 F304L probably damaging Het
Itgad A T 7: 128,198,530 N906Y probably damaging Het
Jakmip2 T C 18: 43,577,400 E246G probably damaging Het
L3mbtl4 A T 17: 68,559,753 H329L probably damaging Het
Mau2 A G 8: 70,033,177 probably null Het
Myo16 T C 8: 10,373,474 L270P probably damaging Het
Naa25 T C 5: 121,430,692 S606P probably damaging Het
Nags T A 11: 102,146,621 C179* probably null Het
Naip2 A G 13: 100,161,536 M664T probably benign Het
Ndufv3 T C 17: 31,528,069 I311T probably benign Het
Nipsnap1 G T 11: 4,891,468 E258* probably null Het
Nudc A G 4: 133,534,349 L208P probably damaging Het
Olfr33 A T 7: 102,713,543 V290E probably damaging Het
Oscp1 A G 4: 126,076,859 D137G possibly damaging Het
Pcdhb5 C T 18: 37,322,471 P635S probably benign Het
Pcdhgb2 T A 18: 37,692,050 I698N probably damaging Het
Pde4b A G 4: 102,597,770 Y399C probably damaging Het
Pdf A T 8: 107,048,180 V140E probably damaging Het
Pglyrp2 T C 17: 32,415,849 N513S probably benign Het
Ranbp2 T A 10: 58,477,056 D1199E possibly damaging Het
Rell2 G T 18: 37,956,568 probably null Het
Rgl2 A G 17: 33,937,173 H745R probably benign Het
Rnf121 A G 7: 102,023,385 C264R probably damaging Het
Rnf181 A G 6: 72,361,516 F3S probably damaging Het
Rsrc1 T A 3: 67,355,602 D296E probably damaging Het
Rubcn A T 16: 32,843,308 D319E probably damaging Het
Scaf8 T C 17: 3,178,219 S431P unknown Het
Sept11 T A 5: 93,162,253 M305K possibly damaging Het
Serpinb12 A G 1: 106,956,402 K293E probably benign Het
Sh3bp1 T A 15: 78,904,338 H229Q probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Specc1 T A 11: 62,211,684 V952E probably damaging Het
Spint2 G A 7: 29,256,786 T158I probably benign Het
St8sia4 A T 1: 95,660,898 W71R probably damaging Het
Tex48 C T 4: 63,611,914 V23I possibly damaging Het
Tmc5 G A 7: 118,645,339 G480D probably benign Het
Tmem8b T A 4: 43,689,713 M330K probably damaging Het
Tnrc18 C T 5: 142,731,340 R2453Q probably damaging Het
Trank1 A T 9: 111,391,895 N2567Y possibly damaging Het
Trps1 T C 15: 50,846,309 D211G probably damaging Het
Ttn T C 2: 76,725,159 R30501G probably damaging Het
Ttn T A 2: 76,742,903 Y25882F probably damaging Het
Unc79 T A 12: 103,173,466 V2495E probably damaging Het
Uqcr10 T A 11: 4,702,198 H58L possibly damaging Het
Usp7 A T 16: 8,756,844 C58* probably null Het
Vmn1r36 A T 6: 66,716,888 M1K probably null Het
Wdr7 T A 18: 63,777,949 M804K probably damaging Het
Zfp131 A C 13: 119,788,858 probably null Het
Zfp507 A G 7: 35,794,055 V521A probably benign Het
Other mutations in Olfr392
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Olfr392 APN 11 73814786 missense probably damaging 0.97
IGL02976:Olfr392 APN 11 73814317 missense probably damaging 0.98
IGL03344:Olfr392 APN 11 73814177 missense probably benign 0.21
R0196:Olfr392 UTSW 11 73814905 missense probably damaging 0.99
R0347:Olfr392 UTSW 11 73814311 missense probably damaging 0.98
R0594:Olfr392 UTSW 11 73814617 missense probably benign 0.12
R0940:Olfr392 UTSW 11 73814224 missense probably damaging 1.00
R1233:Olfr392 UTSW 11 73814350 missense probably damaging 1.00
R1300:Olfr392 UTSW 11 73814246 missense probably benign 0.13
R1490:Olfr392 UTSW 11 73814371 missense possibly damaging 0.95
R3111:Olfr392 UTSW 11 73814186 missense probably benign
R4827:Olfr392 UTSW 11 73814721 nonsense probably null
R4992:Olfr392 UTSW 11 73814320 missense probably damaging 1.00
R6193:Olfr392 UTSW 11 73814824 missense probably benign
R7201:Olfr392 UTSW 11 73814341 missense probably benign 0.19
R7310:Olfr392 UTSW 11 73814286 missense probably damaging 0.98
X0021:Olfr392 UTSW 11 73814305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTCCTATGATGAGGCACAATATC -3'
(R):5'- GAGGGATCATCATTATTATTCCGTTCC -3'

Sequencing Primer
(F):5'- GTGCTACCATTACAGAGAG -3'
(R):5'- ACTCATTGGTATGTCCTATGTAAGG -3'
Posted On2016-03-01