Incidental Mutation 'R6228:Cdc14a'
ID504459
Institutional Source Beutler Lab
Gene Symbol Cdc14a
Ensembl Gene ENSMUSG00000033502
Gene NameCDC14 cell division cycle 14A
SynonymsCDC14A2, Cdc14, CDC14a1, A830059A17Rik
MMRRC Submission 044357-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R6228 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location116272553-116424032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116351213 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 150 (I150N)
Ref Sequence ENSEMBL: ENSMUSP00000087950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090464] [ENSMUST00000106491] [ENSMUST00000197830]
Predicted Effect probably damaging
Transcript: ENSMUST00000090464
AA Change: I150N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087950
Gene: ENSMUSG00000033502
AA Change: I150N

DomainStartEndE-ValueType
Pfam:DSPn 13 153 1.6e-66 PFAM
Pfam:Y_phosphatase 210 324 1.1e-7 PFAM
Pfam:DSPc 214 328 1.8e-14 PFAM
low complexity region 539 558 N/A INTRINSIC
low complexity region 573 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106491
SMART Domains Protein: ENSMUSP00000102100
Gene: ENSMUSG00000033502

DomainStartEndE-ValueType
Pfam:DSPn 12 121 9.5e-44 PFAM
Pfam:Y_phosphatase 160 274 6.4e-8 PFAM
Pfam:DSPc 160 280 2.8e-14 PFAM
low complexity region 490 509 N/A INTRINSIC
low complexity region 524 546 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196669
Predicted Effect probably benign
Transcript: ENSMUST00000197830
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (93/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein tyrosine phosphatase family. It is highly similar to Saccharomyces cerevisiae Cdc14, a protein tyrosine phosphatase involved in the exit of cell mitosis and initiation of DNA replication, suggesting a role in cell cycle control. This protein has been shown to interact with, and dephosphorylate tumor suppressor protein p53, and is thought to regulate the function of p53. Alternative splicing of this gene results in several transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 G T 7: 46,030,256 T9K probably benign Het
Ankrd28 T C 14: 31,707,220 H925R probably damaging Het
Antxrl A T 14: 34,056,599 T128S probably damaging Het
Atp8b5 T C 4: 43,304,674 Y62H probably damaging Het
AU019823 A G 9: 50,607,671 S214P possibly damaging Het
Bmpr2 G T 1: 59,867,436 V563L probably benign Het
Btn1a1 A T 13: 23,464,351 L104Q probably damaging Het
Caskin1 C G 17: 24,507,180 D1420E probably damaging Het
Cdc26 C T 4: 62,402,794 R4Q probably damaging Het
Cfap46 T C 7: 139,656,580 D160G probably damaging Het
Cxcr4 A C 1: 128,592,183 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dgat1 T C 15: 76,503,293 N317S possibly damaging Het
Disp1 G A 1: 183,099,025 T228M possibly damaging Het
Dixdc1 A C 9: 50,703,356 probably null Het
Dnase1l2 C A 17: 24,442,518 probably benign Het
Dsg2 T C 18: 20,594,293 probably null Het
Duox2 A T 2: 122,287,193 F887I probably benign Het
Efcab6 T C 15: 83,967,624 D351G possibly damaging Het
Ep400 A G 5: 110,670,942 V2621A probably damaging Het
Epg5 G T 18: 77,948,462 V125F possibly damaging Het
Ephb1 T C 9: 101,923,584 R953G probably damaging Het
Etfdh G T 3: 79,612,029 Y272* probably null Het
Fam117b A G 1: 59,969,048 E347G probably damaging Het
Fam214a A G 9: 75,006,363 M100V possibly damaging Het
Gfra3 A T 18: 34,695,793 C183S probably damaging Het
Gm4981 A G 10: 58,235,522 M290T probably benign Het
Gmip A G 8: 69,816,123 D466G probably damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Gpd1 A T 15: 99,723,265 Q320L possibly damaging Het
H2-Oa G T 17: 34,093,877 D43Y probably damaging Het
Hecw1 T A 13: 14,346,038 I205F probably damaging Het
Ighv8-13 A G 12: 115,765,353 Y95H probably damaging Het
Igkv6-20 T C 6: 70,336,097 M31V possibly damaging Het
Itih1 T C 14: 30,931,260 D737G probably benign Het
Kcnc4 G C 3: 107,448,377 H252D probably damaging Het
Kcnj14 T A 7: 45,819,497 T195S probably damaging Het
Limch1 A T 5: 67,016,502 D642V probably damaging Het
Lrp2 T G 2: 69,482,366 D2526A possibly damaging Het
Lrrc8a A G 2: 30,256,553 T460A possibly damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Lypd8 A T 11: 58,386,803 Q137L possibly damaging Het
Mapkapk3 A G 9: 107,260,063 Y206H probably damaging Het
Mrc1 G A 2: 14,271,304 G483D probably benign Het
Mrpl35 C A 6: 71,823,677 probably benign Het
Mycbp2 T A 14: 103,260,229 H936L probably benign Het
Myh3 A T 11: 67,087,486 Y433F probably benign Het
Napb C T 2: 148,698,178 probably null Het
Nbeal1 C A 1: 60,295,924 Q2288K probably benign Het
Ndst3 G A 3: 123,671,652 Q224* probably null Het
Nkd2 A G 13: 73,821,460 S284P probably benign Het
Olfr1100 T C 2: 86,978,691 Y35C probably damaging Het
Olfr1448 A T 19: 12,919,937 V124E probably damaging Het
Olfr420 G A 1: 174,152,146 S210N probably benign Het
Olfr714 T C 7: 107,074,136 Y103H probably damaging Het
Pcdhb8 A G 18: 37,356,984 T572A probably benign Het
Pcdhb9 A G 18: 37,402,062 I370V probably benign Het
Pcsk5 T G 19: 17,581,267 E592A possibly damaging Het
Pigc T C 1: 161,970,467 V6A probably benign Het
Pla2g6 T G 15: 79,305,724 I389L probably benign Het
Pnliprp2 T C 19: 58,763,442 probably null Het
Psmb11 T C 14: 54,626,189 V288A probably benign Het
Rapgef5 A G 12: 117,721,663 probably null Het
Rcn3 T C 7: 45,083,296 N316S probably damaging Het
Rgs6 A G 12: 83,065,964 K183E probably damaging Het
Rhoc A G 3: 104,792,981 probably null Het
Serinc5 T C 13: 92,708,108 C453R probably damaging Het
Slc14a1 A C 18: 78,116,399 M93R probably damaging Het
Slc25a3 A T 10: 91,122,228 D83E probably damaging Het
Slc36a3 T C 11: 55,124,951 Y459C probably benign Het
Slc44a5 A T 3: 154,239,163 Y139F probably benign Het
Spag17 A T 3: 100,022,602 Q539L probably benign Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Stard9 A G 2: 120,713,750 Y4450C probably damaging Het
Taf6l C T 19: 8,778,666 R206Q probably benign Het
Tbc1d23 C T 16: 57,182,903 V501I probably damaging Het
Thap2 T C 10: 115,372,846 H123R probably damaging Het
Tlx3 C A 11: 33,202,432 W221L probably benign Het
Tmem262 T A 19: 6,080,537 probably null Het
Tpmt C A 13: 47,027,259 R201S probably benign Het
Trpm6 T C 19: 18,854,291 S1507P probably damaging Het
Ttc9c T C 19: 8,818,483 E64G possibly damaging Het
Ttn A T 2: 76,810,446 S13653T probably damaging Het
Ugt3a1 G T 15: 9,310,640 W336L possibly damaging Het
Vmn1r215 C A 13: 23,076,463 N224K probably benign Het
Vmn2r59 C T 7: 42,042,411 probably null Het
Wdfy3 A G 5: 101,898,429 S1853P possibly damaging Het
Wdr36 A T 18: 32,842,006 Y137F possibly damaging Het
Zdhhc17 T C 10: 110,956,355 D324G probably benign Het
Zfp217 T C 2: 170,119,577 T277A probably benign Het
Zfp451 A G 1: 33,803,138 probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp871 T C 17: 32,775,884 S106G possibly damaging Het
Other mutations in Cdc14a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Cdc14a APN 3 116294844 nonsense probably null
IGL01062:Cdc14a APN 3 116274712 splice site probably benign
IGL01584:Cdc14a APN 3 116392825 nonsense probably null
IGL03084:Cdc14a APN 3 116348452 critical splice donor site probably null
IGL03237:Cdc14a APN 3 116404626 intron probably benign
IGL03296:Cdc14a APN 3 116297158 missense probably benign 0.02
PIT4131001:Cdc14a UTSW 3 116328661 missense possibly damaging 0.66
R0707:Cdc14a UTSW 3 116293713 splice site probably benign
R0782:Cdc14a UTSW 3 116322136 missense probably damaging 1.00
R0835:Cdc14a UTSW 3 116328522 missense probably benign 0.12
R1363:Cdc14a UTSW 3 116293860 small deletion probably benign
R1507:Cdc14a UTSW 3 116293997 missense possibly damaging 0.47
R1545:Cdc14a UTSW 3 116293724 critical splice donor site probably null
R1795:Cdc14a UTSW 3 116298473 missense possibly damaging 0.81
R1797:Cdc14a UTSW 3 116322194 missense probably damaging 1.00
R1830:Cdc14a UTSW 3 116422647 nonsense probably null
R4229:Cdc14a UTSW 3 116293764 missense probably damaging 0.99
R4655:Cdc14a UTSW 3 116328487 missense probably damaging 1.00
R4769:Cdc14a UTSW 3 116294750 critical splice donor site probably null
R4870:Cdc14a UTSW 3 116423460 missense probably benign 0.30
R4980:Cdc14a UTSW 3 116392857 nonsense probably null
R6248:Cdc14a UTSW 3 116308194 missense probably benign 0.01
R6402:Cdc14a UTSW 3 116348459 missense probably damaging 1.00
R6749:Cdc14a UTSW 3 116297158 missense possibly damaging 0.68
R6852:Cdc14a UTSW 3 116328676 missense possibly damaging 0.94
R6996:Cdc14a UTSW 3 116328706 missense probably damaging 1.00
R7185:Cdc14a UTSW 3 116294027 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGAAGATGACGGACATGTG -3'
(R):5'- TGAATAAAGGCCCAGGCTC -3'

Sequencing Primer
(F):5'- CGGACATGTGTGAAATTTTCAAAGG -3'
(R):5'- GAATAAAGGCCCAGGCTCCTCTG -3'
Posted On2018-02-28