Incidental Mutation 'R6228:Pcsk5'
ID504526
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Nameproprotein convertase subtilisin/kexin type 5
SynonymsPC6, SPC6, b2b1549Clo, b2b585Clo, PC5A, PC5/6A
MMRRC Submission 044357-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6228 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location17432832-17837632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 17581267 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 592 (E592A)
Ref Sequence ENSEMBL: ENSMUSP00000050272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618] [ENSMUST00000050715]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025618
AA Change: E592A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713
AA Change: E592A

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000050715
AA Change: E592A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050272
Gene: ENSMUSG00000024713
AA Change: E592A

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
PDB:1KN6|A 35 116 6e-11 PDB
Pfam:Peptidase_S8 168 456 2.9e-59 PFAM
Pfam:P_proprotein 507 597 1.5e-34 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 884 1.4e-8 SMART
EGF_like 839 870 3.43e1 SMART
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (93/93)
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 G T 7: 46,030,256 T9K probably benign Het
Ankrd28 T C 14: 31,707,220 H925R probably damaging Het
Antxrl A T 14: 34,056,599 T128S probably damaging Het
Atp8b5 T C 4: 43,304,674 Y62H probably damaging Het
AU019823 A G 9: 50,607,671 S214P possibly damaging Het
Bmpr2 G T 1: 59,867,436 V563L probably benign Het
Btn1a1 A T 13: 23,464,351 L104Q probably damaging Het
Caskin1 C G 17: 24,507,180 D1420E probably damaging Het
Cdc14a A T 3: 116,351,213 I150N probably damaging Het
Cdc26 C T 4: 62,402,794 R4Q probably damaging Het
Cfap46 T C 7: 139,656,580 D160G probably damaging Het
Cxcr4 A C 1: 128,592,183 probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dgat1 T C 15: 76,503,293 N317S possibly damaging Het
Disp1 G A 1: 183,099,025 T228M possibly damaging Het
Dixdc1 A C 9: 50,703,356 probably null Het
Dnase1l2 C A 17: 24,442,518 probably benign Het
Dsg2 T C 18: 20,594,293 probably null Het
Duox2 A T 2: 122,287,193 F887I probably benign Het
Efcab6 T C 15: 83,967,624 D351G possibly damaging Het
Ep400 A G 5: 110,670,942 V2621A probably damaging Het
Epg5 G T 18: 77,948,462 V125F possibly damaging Het
Ephb1 T C 9: 101,923,584 R953G probably damaging Het
Etfdh G T 3: 79,612,029 Y272* probably null Het
Fam117b A G 1: 59,969,048 E347G probably damaging Het
Fam214a A G 9: 75,006,363 M100V possibly damaging Het
Gfra3 A T 18: 34,695,793 C183S probably damaging Het
Gm4981 A G 10: 58,235,522 M290T probably benign Het
Gmip A G 8: 69,816,123 D466G probably damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Gpd1 A T 15: 99,723,265 Q320L possibly damaging Het
H2-Oa G T 17: 34,093,877 D43Y probably damaging Het
Hecw1 T A 13: 14,346,038 I205F probably damaging Het
Ighv8-13 A G 12: 115,765,353 Y95H probably damaging Het
Igkv6-20 T C 6: 70,336,097 M31V possibly damaging Het
Itih1 T C 14: 30,931,260 D737G probably benign Het
Kcnc4 G C 3: 107,448,377 H252D probably damaging Het
Kcnj14 T A 7: 45,819,497 T195S probably damaging Het
Limch1 A T 5: 67,016,502 D642V probably damaging Het
Lrp2 T G 2: 69,482,366 D2526A possibly damaging Het
Lrrc8a A G 2: 30,256,553 T460A possibly damaging Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Lypd8 A T 11: 58,386,803 Q137L possibly damaging Het
Mapkapk3 A G 9: 107,260,063 Y206H probably damaging Het
Mrc1 G A 2: 14,271,304 G483D probably benign Het
Mrpl35 C A 6: 71,823,677 probably benign Het
Mycbp2 T A 14: 103,260,229 H936L probably benign Het
Myh3 A T 11: 67,087,486 Y433F probably benign Het
Napb C T 2: 148,698,178 probably null Het
Nbeal1 C A 1: 60,295,924 Q2288K probably benign Het
Ndst3 G A 3: 123,671,652 Q224* probably null Het
Nkd2 A G 13: 73,821,460 S284P probably benign Het
Olfr1100 T C 2: 86,978,691 Y35C probably damaging Het
Olfr1448 A T 19: 12,919,937 V124E probably damaging Het
Olfr420 G A 1: 174,152,146 S210N probably benign Het
Olfr714 T C 7: 107,074,136 Y103H probably damaging Het
Pcdhb8 A G 18: 37,356,984 T572A probably benign Het
Pcdhb9 A G 18: 37,402,062 I370V probably benign Het
Pigc T C 1: 161,970,467 V6A probably benign Het
Pla2g6 T G 15: 79,305,724 I389L probably benign Het
Pnliprp2 T C 19: 58,763,442 probably null Het
Psmb11 T C 14: 54,626,189 V288A probably benign Het
Rapgef5 A G 12: 117,721,663 probably null Het
Rcn3 T C 7: 45,083,296 N316S probably damaging Het
Rgs6 A G 12: 83,065,964 K183E probably damaging Het
Rhoc A G 3: 104,792,981 probably null Het
Serinc5 T C 13: 92,708,108 C453R probably damaging Het
Slc14a1 A C 18: 78,116,399 M93R probably damaging Het
Slc25a3 A T 10: 91,122,228 D83E probably damaging Het
Slc36a3 T C 11: 55,124,951 Y459C probably benign Het
Slc44a5 A T 3: 154,239,163 Y139F probably benign Het
Spag17 A T 3: 100,022,602 Q539L probably benign Het
Stap2 C T 17: 55,999,976 V234M probably damaging Het
Stard9 A G 2: 120,713,750 Y4450C probably damaging Het
Taf6l C T 19: 8,778,666 R206Q probably benign Het
Tbc1d23 C T 16: 57,182,903 V501I probably damaging Het
Thap2 T C 10: 115,372,846 H123R probably damaging Het
Tlx3 C A 11: 33,202,432 W221L probably benign Het
Tmem262 T A 19: 6,080,537 probably null Het
Tpmt C A 13: 47,027,259 R201S probably benign Het
Trpm6 T C 19: 18,854,291 S1507P probably damaging Het
Ttc9c T C 19: 8,818,483 E64G possibly damaging Het
Ttn A T 2: 76,810,446 S13653T probably damaging Het
Ugt3a1 G T 15: 9,310,640 W336L possibly damaging Het
Vmn1r215 C A 13: 23,076,463 N224K probably benign Het
Vmn2r59 C T 7: 42,042,411 probably null Het
Wdfy3 A G 5: 101,898,429 S1853P possibly damaging Het
Wdr36 A T 18: 32,842,006 Y137F possibly damaging Het
Zdhhc17 T C 10: 110,956,355 D324G probably benign Het
Zfp217 T C 2: 170,119,577 T277A probably benign Het
Zfp451 A G 1: 33,803,138 probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Zfp871 T C 17: 32,775,884 S106G possibly damaging Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17511421 missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17642559 missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17451958 missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17617744 missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17433780 splice site probably benign
IGL01874:Pcsk5 APN 19 17595677 missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17439042 missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17433420 nonsense probably null
IGL02436:Pcsk5 APN 19 17564708 critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17511556 missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17477872 critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17456770 missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17675468 missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17447501 missense probably damaging 1.00
PIT4377001:Pcsk5 UTSW 19 17439102 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17654849 missense probably damaging 1.00
R0784:Pcsk5 UTSW 19 17714769 missense probably benign 0.06
R0843:Pcsk5 UTSW 19 17654818 missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17564830 missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R1435:Pcsk5 UTSW 19 17563882 nonsense probably null
R1471:Pcsk5 UTSW 19 17568324 missense probably damaging 1.00
R1564:Pcsk5 UTSW 19 17654756 missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17436600 missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17515256 missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17447574 missense probably damaging 0.98
R1671:Pcsk5 UTSW 19 17454868 missense probably damaging 1.00
R1703:Pcsk5 UTSW 19 17752094 missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17454750 missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17515192 missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17433461 missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17433418 missense unknown
R2006:Pcsk5 UTSW 19 17477916 missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17581144 missense possibly damaging 0.48
R2061:Pcsk5 UTSW 19 17454872 missense probably benign 0.03
R2110:Pcsk5 UTSW 19 17473059 missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17474834 nonsense probably null
R2496:Pcsk5 UTSW 19 17466158 nonsense probably null
R4115:Pcsk5 UTSW 19 17433419 missense unknown
R4504:Pcsk5 UTSW 19 17451955 missense probably damaging 1.00
R4616:Pcsk5 UTSW 19 17560750 missense probably benign 0.00
R4683:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17525267 missense probably damaging 1.00
R4761:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R4789:Pcsk5 UTSW 19 17433599 missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17447690 missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17515135 critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17675585 missense probably damaging 1.00
R5116:Pcsk5 UTSW 19 17463434 missense possibly damaging 0.87
R5193:Pcsk5 UTSW 19 17564810 missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17595658 splice site probably null
R5334:Pcsk5 UTSW 19 17461851 missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17581255 missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17463356 missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17752124 missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17575831 missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17456829 missense probably benign 0.01
R6063:Pcsk5 UTSW 19 17454681 critical splice donor site probably null
R6130:Pcsk5 UTSW 19 17511556 missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17511492 missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17836953 critical splice donor site probably null
R6426:Pcsk5 UTSW 19 17617729 missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17511380 missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17575821 missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17456786 missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17572622 splice site probably null
R6837:Pcsk5 UTSW 19 17439084 missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17473112 missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17433731 missense probably benign 0.00
R7164:Pcsk5 UTSW 19 17451985 missense probably damaging 1.00
R7173:Pcsk5 UTSW 19 17477877 missense possibly damaging 0.85
R7348:Pcsk5 UTSW 19 17456818 nonsense probably null
R7360:Pcsk5 UTSW 19 17515213 missense probably benign 0.00
R7407:Pcsk5 UTSW 19 17675516 missense probably damaging 1.00
R7447:Pcsk5 UTSW 19 17510236 missense probably benign 0.31
R7521:Pcsk5 UTSW 19 17454832 missense probably benign 0.29
R7525:Pcsk5 UTSW 19 17642590 missense probably damaging 1.00
R7560:Pcsk5 UTSW 19 17836972 missense probably benign 0.01
R7566:Pcsk5 UTSW 19 17572457 missense probably benign
X0023:Pcsk5 UTSW 19 17474872 missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17447604 missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17463374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACATGCCAGGAATATGCCC -3'
(R):5'- CTTCCTATTGTGGGCGCTCAAG -3'

Sequencing Primer
(F):5'- CCAGGAATATGCCCAAGCTTTTG -3'
(R):5'- TATGGCCTGTGAACTGGGAAATCC -3'
Posted On2018-02-28