Incidental Mutation 'R6262:Olfr716'
ID506762
Institutional Source Beutler Lab
Gene Symbol Olfr716
Ensembl Gene ENSMUSG00000073896
Gene Nameolfactory receptor 716
SynonymsGA_x6K02T2PBJ9-9497411-9498355, MOR260-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6262 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107138327-107150581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107147711 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 132 (Y132H)
Ref Sequence ENSEMBL: ENSMUSP00000150175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098137] [ENSMUST00000209942] [ENSMUST00000210474] [ENSMUST00000213367] [ENSMUST00000214819] [ENSMUST00000215284] [ENSMUST00000216871]
Predicted Effect probably damaging
Transcript: ENSMUST00000098137
AA Change: Y132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095740
Gene: ENSMUSG00000073896
AA Change: Y132H

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.4e-57 PFAM
Pfam:7tm_1 41 290 3.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209942
Predicted Effect probably damaging
Transcript: ENSMUST00000210474
AA Change: Y132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213367
AA Change: Y132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214819
AA Change: Y132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215284
AA Change: Y132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216871
AA Change: Y132H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 G A 4: 53,092,917 T289I probably benign Het
Abca2 T C 2: 25,444,910 Y1965H possibly damaging Het
Adam26a T C 8: 43,569,088 N455S possibly damaging Het
Art5 C T 7: 102,098,131 G147D probably benign Het
Atp5a1 G A 18: 77,781,212 V429M probably damaging Het
Calr4 A T 4: 109,251,367 N213I probably damaging Het
Cchcr1 T C 17: 35,530,516 S810P probably benign Het
Cdh4 A T 2: 179,797,626 R189W probably damaging Het
Cdk5rap1 T C 2: 154,370,686 D84G probably benign Het
Clasp2 T A 9: 113,876,352 probably null Het
Cntnap2 T A 6: 45,060,112 probably null Het
Cntnap4 T C 8: 112,803,211 Y684H probably damaging Het
Cyp2a4 T A 7: 26,312,230 V292E probably damaging Het
Dap A G 15: 31,235,814 T10A probably benign Het
Dnah11 G A 12: 117,931,178 R3645C probably damaging Het
Dnah9 A T 11: 65,881,805 probably null Het
Efr3a T C 15: 65,857,474 S675P possibly damaging Het
Gm11639 T A 11: 104,893,753 M2787K probably benign Het
Gria1 A G 11: 57,242,854 K451E probably damaging Het
Grin3b A T 10: 79,974,369 M570L probably benign Het
Hs2st1 A G 3: 144,434,613 F316L probably damaging Het
Hs6st3 A G 14: 119,138,991 T193A possibly damaging Het
Hspg2 A T 4: 137,519,686 D1108V probably damaging Het
Igf1r T A 7: 68,003,972 L86Q probably damaging Het
Inpp5j A G 11: 3,502,615 S212P probably benign Het
Junb A G 8: 84,977,730 S234P possibly damaging Het
Lhx3 GTGTTGT GTGT 2: 26,202,423 probably benign Het
Macf1 A G 4: 123,473,190 S1028P possibly damaging Het
Met C A 6: 17,553,404 A1063E probably benign Het
Mink1 T C 11: 70,603,325 probably null Het
Mtor A G 4: 148,526,095 E1621G possibly damaging Het
Mug2 T C 6: 122,075,255 Y991H probably damaging Het
Neb T C 2: 52,308,687 D414G probably damaging Het
Nkx6-3 T C 8: 23,153,847 V88A probably benign Het
Nr3c2 A G 8: 76,908,633 Q121R possibly damaging Het
Nup155 T C 15: 8,156,741 V1329A probably benign Het
Olfr1161 T C 2: 88,025,394 V224A probably benign Het
Pcdhb17 T A 18: 37,486,698 F514I probably damaging Het
Pfkl A G 10: 77,988,673 probably null Het
Prl8a1 A T 13: 27,574,143 H194Q possibly damaging Het
Sh3tc1 C G 5: 35,699,773 E1241Q probably damaging Het
Slc6a6 A T 6: 91,755,032 H614L possibly damaging Het
Sort1 A G 3: 108,310,211 Y143C probably damaging Het
Stat4 T A 1: 52,102,201 W569R probably null Het
Taco1 A T 11: 106,071,867 K127* probably null Het
Tas2r110 T C 6: 132,868,675 I223T probably damaging Het
Tex21 A G 12: 76,212,532 I329T probably damaging Het
Tmprss11b T C 5: 86,662,260 H287R probably benign Het
Trim30a A G 7: 104,411,534 L345P probably benign Het
Vmn1r62 G A 7: 5,675,557 C79Y probably damaging Het
Vmn2r116 A G 17: 23,387,377 K421R probably benign Het
Vwde C T 6: 13,205,021 S287N probably damaging Het
Xrcc4 A T 13: 89,778,787 M300K probably benign Het
Zan A T 5: 137,429,485 probably null Het
Zbtb7c A G 18: 76,137,342 D167G probably benign Het
Zfc3h1 A G 10: 115,413,976 Y1165C probably damaging Het
Zfp326 T A 5: 105,888,487 L88Q probably damaging Het
Zfp667 A G 7: 6,304,974 T214A probably benign Het
Other mutations in Olfr716
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01781:Olfr716 APN 7 107147696 missense probably damaging 1.00
IGL02792:Olfr716 APN 7 107148218 missense probably benign 0.00
IGL03300:Olfr716 APN 7 107147409 missense probably damaging 1.00
R0071:Olfr716 UTSW 7 107147712 missense probably damaging 1.00
R0071:Olfr716 UTSW 7 107147712 missense probably damaging 1.00
R0391:Olfr716 UTSW 7 107148187 nonsense probably null
R0962:Olfr716 UTSW 7 107148087 missense possibly damaging 0.94
R1440:Olfr716 UTSW 7 107148198 missense probably damaging 1.00
R5561:Olfr716 UTSW 7 107148090 missense probably benign 0.05
R5700:Olfr716 UTSW 7 107147541 missense probably benign
R5997:Olfr716 UTSW 7 107147328 missense possibly damaging 0.79
R6922:Olfr716 UTSW 7 107148083 missense probably damaging 0.98
R7076:Olfr716 UTSW 7 107148029 missense probably damaging 1.00
Z1088:Olfr716 UTSW 7 107148212 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAGCATTGTTCCTCAAGTGCTG -3'
(R):5'- AGGAGGATTACCACACCCATTG -3'

Sequencing Primer
(F):5'- TGTCCCACTTCCTGGTAAAAAGG -3'
(R):5'- GCTGTAAGTATCTGCTGAAGCCAC -3'
Posted On2018-03-15