Incidental Mutation 'R6264:Dedd2'
ID506882
Institutional Source Beutler Lab
Gene Symbol Dedd2
Ensembl Gene ENSMUSG00000054499
Gene Namedeath effector domain-containing DNA binding protein 2
SynonymsFLAME-3, 2410050E11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6264 (G1)
Quality Score145.008
Status Not validated
Chromosome7
Chromosomal Location25199915-25220615 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25203790 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 248 (L248P)
Ref Sequence ENSEMBL: ENSMUSP00000146052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058702] [ENSMUST00000205271]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058702
AA Change: L248P

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049763
Gene: ENSMUSG00000054499
AA Change: L248P

DomainStartEndE-ValueType
DED 24 104 6.34e-13 SMART
low complexity region 130 147 N/A INTRINSIC
low complexity region 157 182 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205271
AA Change: L248P

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206750
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-localized protein containing a death effector domain (DED). The encoded protein may regulate the trafficking of caspases and other proteins into the nucleus during death receptor-induced apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,373,998 Y175H probably damaging Het
Agtpbp1 A T 13: 59,450,300 V1165D possibly damaging Het
Ahsg A G 16: 22,898,861 D224G probably benign Het
Akap11 T C 14: 78,512,421 D842G possibly damaging Het
Anln T C 9: 22,334,117 N186D possibly damaging Het
Aqr A G 2: 114,109,964 Y1234H probably damaging Het
Ccdc162 A G 10: 41,694,468 F7S probably benign Het
Cltc T C 11: 86,705,258 Y1222C probably damaging Het
Coro2a C T 4: 46,562,912 V81I probably damaging Het
Cpa5 T C 6: 30,613,985 V42A probably damaging Het
D2hgdh A G 1: 93,826,455 Y50C probably damaging Het
Ddx6 A G 9: 44,628,752 N326D probably damaging Het
Frem3 T A 8: 80,615,203 I1375N probably damaging Het
Gm12185 T C 11: 48,916,175 N63S probably benign Het
Gm13089 T G 4: 143,699,152 T74P possibly damaging Het
H2-Aa A G 17: 34,283,198 S250P probably damaging Het
Hbs1l T C 10: 21,367,757 S667P possibly damaging Het
Hc T A 2: 35,006,273 probably null Het
Hoxd4 A T 2: 74,727,385 Y36F possibly damaging Het
Ifi207 A G 1: 173,727,545 V864A probably damaging Het
Igsf10 T A 3: 59,328,507 T1418S possibly damaging Het
Klhl41 T C 2: 69,679,832 probably null Het
Lman2l T C 1: 36,438,769 N162S probably damaging Het
Lrr1 T G 12: 69,168,881 V9G probably damaging Het
March5 T C 19: 37,220,741 I127T probably damaging Het
Med12l T C 3: 59,256,002 L1350P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 T A 11: 68,745,415 I210N probably benign Het
Myo5c A G 9: 75,275,554 N825S probably benign Het
Nav3 T C 10: 109,688,833 T2312A probably damaging Het
Ndrg4 G T 8: 95,709,768 R208L probably damaging Het
Nell2 G A 15: 95,346,825 P464S probably damaging Het
Nrxn3 T A 12: 90,332,237 Y374N probably damaging Het
Oprd1 A C 4: 132,114,054 C198G possibly damaging Het
Pik3ca T C 3: 32,440,714 probably null Het
Plin4 T G 17: 56,104,787 D748A possibly damaging Het
Prkg2 T G 5: 98,934,364 K52Q probably benign Het
Ptprk A T 10: 28,566,673 E890D probably damaging Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Ranbp6 T C 19: 29,812,626 T109A probably benign Het
Rarb T A 14: 16,818,819 M17L probably benign Het
Rasgrf2 T C 13: 92,030,785 H260R probably damaging Het
Rec8 T A 14: 55,619,179 D109E probably damaging Het
Scd4 C A 19: 44,338,959 S158* probably null Het
Scn7a T A 2: 66,675,526 E1673V possibly damaging Het
Sit1 A T 4: 43,482,651 D169E possibly damaging Het
Slc16a14 G T 1: 84,907,409 Q470K probably benign Het
Slc43a2 T A 11: 75,567,074 C392S possibly damaging Het
Smg1 A G 7: 118,166,087 probably benign Het
Sstr2 A T 11: 113,625,106 I284F probably damaging Het
Tep1 C T 14: 50,845,513 V1013M probably damaging Het
Tmem120b T G 5: 123,115,700 L232R probably damaging Het
Tmem9b C A 7: 109,745,405 V75F probably damaging Het
Trappc3 A G 4: 126,273,938 S97G probably damaging Het
Ube3c T C 5: 29,590,831 F73L probably damaging Het
Vmn1r127 C A 7: 21,319,005 C286F probably benign Het
Vmn1r44 T C 6: 89,893,670 S133P probably benign Het
Vps8 C T 16: 21,559,349 Q635* probably null Het
Vwa8 A G 14: 79,086,812 E1185G possibly damaging Het
Zfp354c G A 11: 50,815,447 T267I probably benign Het
Other mutations in Dedd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0346:Dedd2 UTSW 7 25211269 missense possibly damaging 0.46
R0480:Dedd2 UTSW 7 25203625 missense probably damaging 1.00
R0838:Dedd2 UTSW 7 25211187 missense probably benign 0.10
R5000:Dedd2 UTSW 7 25203643 missense possibly damaging 0.91
R5085:Dedd2 UTSW 7 25218986 missense probably damaging 1.00
R6082:Dedd2 UTSW 7 25211290 missense probably benign 0.02
R6083:Dedd2 UTSW 7 25211290 missense probably benign 0.02
R6084:Dedd2 UTSW 7 25211290 missense probably benign 0.02
R6646:Dedd2 UTSW 7 25203613 missense probably damaging 1.00
R6733:Dedd2 UTSW 7 25203907 missense probably benign 0.30
R7267:Dedd2 UTSW 7 25218966 missense probably damaging 0.99
Z1176:Dedd2 UTSW 7 25203598 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGTCAGCCTCGTCCACACTG -3'
(R):5'- GTAGCAGAGAGGGGTAGTCTTC -3'

Sequencing Primer
(F):5'- CTGACCAGCAAGCGGACAG -3'
(R):5'- GGAAGCGTGGTTCCTGC -3'
Posted On2018-03-15