Incidental Mutation 'R6264:Slc16a14'
ID 506860
Institutional Source Beutler Lab
Gene Symbol Slc16a14
Ensembl Gene ENSMUSG00000026220
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 14
Synonyms 1110004H10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R6264 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 84905898-84935134 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 84907409 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 470 (Q470K)
Ref Sequence ENSEMBL: ENSMUSP00000027422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027422]
AlphaFold Q8K1C7
Predicted Effect probably benign
Transcript: ENSMUST00000027422
AA Change: Q470K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027422
Gene: ENSMUSG00000026220
AA Change: Q470K

DomainStartEndE-ValueType
Pfam:MFS_1 42 427 6.7e-42 PFAM
Pfam:MFS_1 419 509 7.9e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,373,998 Y175H probably damaging Het
Agtpbp1 A T 13: 59,450,300 V1165D possibly damaging Het
Ahsg A G 16: 22,898,861 D224G probably benign Het
Akap11 T C 14: 78,512,421 D842G possibly damaging Het
Anln T C 9: 22,334,117 N186D possibly damaging Het
Aqr A G 2: 114,109,964 Y1234H probably damaging Het
Ccdc162 A G 10: 41,694,468 F7S probably benign Het
Cltc T C 11: 86,705,258 Y1222C probably damaging Het
Coro2a C T 4: 46,562,912 V81I probably damaging Het
Cpa5 T C 6: 30,613,985 V42A probably damaging Het
D2hgdh A G 1: 93,826,455 Y50C probably damaging Het
Ddx6 A G 9: 44,628,752 N326D probably damaging Het
Dedd2 A G 7: 25,203,790 L248P possibly damaging Het
Frem3 T A 8: 80,615,203 I1375N probably damaging Het
Gm12185 T C 11: 48,916,175 N63S probably benign Het
Gm13089 T G 4: 143,699,152 T74P possibly damaging Het
H2-Aa A G 17: 34,283,198 S250P probably damaging Het
Hbs1l T C 10: 21,367,757 S667P possibly damaging Het
Hc T A 2: 35,006,273 probably null Het
Hoxd4 A T 2: 74,727,385 Y36F possibly damaging Het
Ifi207 A G 1: 173,727,545 V864A probably damaging Het
Igsf10 T A 3: 59,328,507 T1418S possibly damaging Het
Klhl41 T C 2: 69,679,832 probably null Het
Lman2l T C 1: 36,438,769 N162S probably damaging Het
Lrr1 T G 12: 69,168,881 V9G probably damaging Het
March5 T C 19: 37,220,741 I127T probably damaging Het
Med12l T C 3: 59,256,002 L1350P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 T A 11: 68,745,415 I210N probably benign Het
Myo5c A G 9: 75,275,554 N825S probably benign Het
Nav3 T C 10: 109,688,833 T2312A probably damaging Het
Ndrg4 G T 8: 95,709,768 R208L probably damaging Het
Nell2 G A 15: 95,346,825 P464S probably damaging Het
Nrxn3 T A 12: 90,332,237 Y374N probably damaging Het
Oprd1 A C 4: 132,114,054 C198G possibly damaging Het
Pik3ca T C 3: 32,440,714 probably null Het
Plin4 T G 17: 56,104,787 D748A possibly damaging Het
Prkg2 T G 5: 98,934,364 K52Q probably benign Het
Ptprk A T 10: 28,566,673 E890D probably damaging Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Ranbp6 T C 19: 29,812,626 T109A probably benign Het
Rarb T A 14: 16,818,819 M17L probably benign Het
Rasgrf2 T C 13: 92,030,785 H260R probably damaging Het
Rec8 T A 14: 55,619,179 D109E probably damaging Het
Scd4 C A 19: 44,338,959 S158* probably null Het
Scn7a T A 2: 66,675,526 E1673V possibly damaging Het
Sit1 A T 4: 43,482,651 D169E possibly damaging Het
Slc43a2 T A 11: 75,567,074 C392S possibly damaging Het
Smg1 A G 7: 118,166,087 probably benign Het
Sstr2 A T 11: 113,625,106 I284F probably damaging Het
Tep1 C T 14: 50,845,513 V1013M probably damaging Het
Tmem120b T G 5: 123,115,700 L232R probably damaging Het
Tmem9b C A 7: 109,745,405 V75F probably damaging Het
Trappc3 A G 4: 126,273,938 S97G probably damaging Het
Ube3c T C 5: 29,590,831 F73L probably damaging Het
Vmn1r127 C A 7: 21,319,005 C286F probably benign Het
Vmn1r44 T C 6: 89,893,670 S133P probably benign Het
Vps8 C T 16: 21,559,349 Q635* probably null Het
Vwa8 A G 14: 79,086,812 E1185G possibly damaging Het
Zfp354c G A 11: 50,815,447 T267I probably benign Het
Other mutations in Slc16a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slc16a14 APN 1 84922871 missense probably damaging 0.99
IGL01563:Slc16a14 APN 1 84912187 splice site probably benign
R0315:Slc16a14 UTSW 1 84912496 missense possibly damaging 0.46
R0380:Slc16a14 UTSW 1 84929530 missense possibly damaging 0.72
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1837:Slc16a14 UTSW 1 84912399 missense probably benign 0.02
R2149:Slc16a14 UTSW 1 84907399 missense probably damaging 1.00
R2293:Slc16a14 UTSW 1 84912843 missense probably benign
R3790:Slc16a14 UTSW 1 84929280 unclassified probably benign
R4016:Slc16a14 UTSW 1 84912507 nonsense probably null
R4596:Slc16a14 UTSW 1 84929357 missense probably damaging 1.00
R4637:Slc16a14 UTSW 1 84907282 missense possibly damaging 0.86
R4723:Slc16a14 UTSW 1 84913020 missense probably damaging 1.00
R5137:Slc16a14 UTSW 1 84912597 missense probably damaging 1.00
R5262:Slc16a14 UTSW 1 84912891 missense probably benign 0.00
R5410:Slc16a14 UTSW 1 84907424 missense probably damaging 0.98
R5927:Slc16a14 UTSW 1 84912267 missense possibly damaging 0.91
R5968:Slc16a14 UTSW 1 84912505 missense possibly damaging 0.70
R6052:Slc16a14 UTSW 1 84912709 missense possibly damaging 0.75
R6290:Slc16a14 UTSW 1 84907385 missense probably benign 0.10
R7383:Slc16a14 UTSW 1 84912571 missense probably damaging 1.00
R7390:Slc16a14 UTSW 1 84929466 missense probably benign 0.25
R7535:Slc16a14 UTSW 1 84913122 missense probably damaging 1.00
R8326:Slc16a14 UTSW 1 84912345 missense possibly damaging 0.94
R8669:Slc16a14 UTSW 1 84922884 missense probably benign 0.00
R8784:Slc16a14 UTSW 1 84913063 missense probably benign 0.01
R9409:Slc16a14 UTSW 1 84929395 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGTTCCTCTAGGAGCCAG -3'
(R):5'- AGATCTTGTATCAACTCTGGGTTCC -3'

Sequencing Primer
(F):5'- TTCCTCTAGGAGCCAGGTGAG -3'
(R):5'- CGTAGCAATAAATGCGTGG -3'
Posted On 2018-03-15