Incidental Mutation 'R6264:Ndrg4'
ID506886
Institutional Source Beutler Lab
Gene Symbol Ndrg4
Ensembl Gene ENSMUSG00000036564
Gene NameN-myc downstream regulated gene 4
SynonymsD8Bwg1337e, Ndr1-rs, SMAP-8, Ndr4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6264 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location95676980-95715119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 95709768 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 208 (R208L)
Ref Sequence ENSEMBL: ENSMUSP00000079495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041318] [ENSMUST00000073139] [ENSMUST00000080666] [ENSMUST00000160964] [ENSMUST00000162578] [ENSMUST00000166358] [ENSMUST00000212160]
Predicted Effect probably damaging
Transcript: ENSMUST00000041318
AA Change: R260L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000036226
Gene: ENSMUSG00000036564
AA Change: R260L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ndr 60 342 3.1e-126 PFAM
low complexity region 360 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073139
AA Change: R208L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000072883
Gene: ENSMUSG00000036564
AA Change: R208L

DomainStartEndE-ValueType
Pfam:Ndr 8 290 2e-126 PFAM
Pfam:Abhydrolase_6 43 278 1.2e-16 PFAM
low complexity region 308 323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000080666
AA Change: R208L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079495
Gene: ENSMUSG00000036564
AA Change: R208L

DomainStartEndE-ValueType
Pfam:Ndr 8 290 9.9e-127 PFAM
Pfam:Abhydrolase_6 43 278 1.1e-16 PFAM
low complexity region 295 310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159851
Predicted Effect probably benign
Transcript: ENSMUST00000160915
Predicted Effect probably benign
Transcript: ENSMUST00000160964
SMART Domains Protein: ENSMUSP00000125703
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
Pfam:Ndr 40 225 6.8e-85 PFAM
Pfam:Abhydrolase_6 75 223 5.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161314
Predicted Effect probably benign
Transcript: ENSMUST00000162578
Predicted Effect probably benign
Transcript: ENSMUST00000166358
SMART Domains Protein: ENSMUSP00000131203
Gene: ENSMUSG00000036564

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000212160
AA Change: R160L

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that is required for cell cycle progression and survival in primary astrocytes and may be involved in the regulation of mitogenic signalling in vascular smooth muscles cells. Alternative splicing results in multiple transcripts encoding different isoforms.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spatial learning deficits and increased susceptibility to ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A G 11: 94,373,998 Y175H probably damaging Het
Agtpbp1 A T 13: 59,450,300 V1165D possibly damaging Het
Ahsg A G 16: 22,898,861 D224G probably benign Het
Akap11 T C 14: 78,512,421 D842G possibly damaging Het
Anln T C 9: 22,334,117 N186D possibly damaging Het
Aqr A G 2: 114,109,964 Y1234H probably damaging Het
Ccdc162 A G 10: 41,694,468 F7S probably benign Het
Cltc T C 11: 86,705,258 Y1222C probably damaging Het
Coro2a C T 4: 46,562,912 V81I probably damaging Het
Cpa5 T C 6: 30,613,985 V42A probably damaging Het
D2hgdh A G 1: 93,826,455 Y50C probably damaging Het
Ddx6 A G 9: 44,628,752 N326D probably damaging Het
Dedd2 A G 7: 25,203,790 L248P possibly damaging Het
Frem3 T A 8: 80,615,203 I1375N probably damaging Het
Gm12185 T C 11: 48,916,175 N63S probably benign Het
Gm13089 T G 4: 143,699,152 T74P possibly damaging Het
H2-Aa A G 17: 34,283,198 S250P probably damaging Het
Hbs1l T C 10: 21,367,757 S667P possibly damaging Het
Hc T A 2: 35,006,273 probably null Het
Hoxd4 A T 2: 74,727,385 Y36F possibly damaging Het
Ifi207 A G 1: 173,727,545 V864A probably damaging Het
Igsf10 T A 3: 59,328,507 T1418S possibly damaging Het
Klhl41 T C 2: 69,679,832 probably null Het
Lman2l T C 1: 36,438,769 N162S probably damaging Het
Lrr1 T G 12: 69,168,881 V9G probably damaging Het
March5 T C 19: 37,220,741 I127T probably damaging Het
Med12l T C 3: 59,256,002 L1350P probably damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Myh10 T A 11: 68,745,415 I210N probably benign Het
Myo5c A G 9: 75,275,554 N825S probably benign Het
Nav3 T C 10: 109,688,833 T2312A probably damaging Het
Nell2 G A 15: 95,346,825 P464S probably damaging Het
Nrxn3 T A 12: 90,332,237 Y374N probably damaging Het
Oprd1 A C 4: 132,114,054 C198G possibly damaging Het
Pik3ca T C 3: 32,440,714 probably null Het
Plin4 T G 17: 56,104,787 D748A possibly damaging Het
Prkg2 T G 5: 98,934,364 K52Q probably benign Het
Ptprk A T 10: 28,566,673 E890D probably damaging Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Ranbp6 T C 19: 29,812,626 T109A probably benign Het
Rarb T A 14: 16,818,819 M17L probably benign Het
Rasgrf2 T C 13: 92,030,785 H260R probably damaging Het
Rec8 T A 14: 55,619,179 D109E probably damaging Het
Scd4 C A 19: 44,338,959 S158* probably null Het
Scn7a T A 2: 66,675,526 E1673V possibly damaging Het
Sit1 A T 4: 43,482,651 D169E possibly damaging Het
Slc16a14 G T 1: 84,907,409 Q470K probably benign Het
Slc43a2 T A 11: 75,567,074 C392S possibly damaging Het
Smg1 A G 7: 118,166,087 probably benign Het
Sstr2 A T 11: 113,625,106 I284F probably damaging Het
Tep1 C T 14: 50,845,513 V1013M probably damaging Het
Tmem120b T G 5: 123,115,700 L232R probably damaging Het
Tmem9b C A 7: 109,745,405 V75F probably damaging Het
Trappc3 A G 4: 126,273,938 S97G probably damaging Het
Ube3c T C 5: 29,590,831 F73L probably damaging Het
Vmn1r127 C A 7: 21,319,005 C286F probably benign Het
Vmn1r44 T C 6: 89,893,670 S133P probably benign Het
Vps8 C T 16: 21,559,349 Q635* probably null Het
Vwa8 A G 14: 79,086,812 E1185G possibly damaging Het
Zfp354c G A 11: 50,815,447 T267I probably benign Het
Other mutations in Ndrg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01504:Ndrg4 APN 8 95706266 missense probably damaging 1.00
IGL01832:Ndrg4 APN 8 95713319 missense probably damaging 1.00
R0325:Ndrg4 UTSW 8 95710935 missense probably damaging 1.00
R1710:Ndrg4 UTSW 8 95710686 missense probably damaging 1.00
R1716:Ndrg4 UTSW 8 95712328 missense probably benign 0.00
R2393:Ndrg4 UTSW 8 95706211 nonsense probably null
R2897:Ndrg4 UTSW 8 95678386 splice site probably null
R2898:Ndrg4 UTSW 8 95678386 splice site probably null
R5838:Ndrg4 UTSW 8 95706793 missense probably damaging 1.00
R6893:Ndrg4 UTSW 8 95706601 nonsense probably null
R8070:Ndrg4 UTSW 8 95700128 missense possibly damaging 0.69
Z1177:Ndrg4 UTSW 8 95710961 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTACAAGTAAGGGCGAGACC -3'
(R):5'- CAGGTGCATTATCTCCGACTAC -3'

Sequencing Primer
(F):5'- CATATGTGTGGTCCCAGAGCAG -3'
(R):5'- ATTATCTCCGACTACCAGCATCACTG -3'
Posted On2018-03-15