Mutagenetix > Incidental Mutation

Incidental Mutation 'R6264:Lman2l'

506859

Institutional Source

Beutler Lab

Gene Symbol

Lman2l

Ensembl Gene

ENSMUSG00000001143

Gene Name

lectin, mannose-binding 2-like

Synonyms

A630028F14Rik, VIP36-like

Accession Numbers

Essential gene?

Probably essential (E-score: 0.810) question?

Stock #

R6264 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

36458952-36484352 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36477850 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 162 (N162S)

Ref Sequence

ENSEMBL: ENSMUSP00000110663 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001171] [ENSMUST00000115011] [ENSMUST00000123583] [ENSMUST00000125304]

AlphaFold

P59481

Predicted Effect

probably benign
Transcript: ENSMUST00000001171

SMART Domains

Protein: ENSMUSP00000137028
Gene: ENSMUSG00000001143

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Lectin_leg-like	48	146	1.5e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115011
AA Change: N162S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110663
Gene: ENSMUSG00000001143
AA Change: N162S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Lectin_leg-like	48	286	2e-84	PFAM
transmembrane domain	324	346	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123583

SMART Domains

Protein: ENSMUSP00000137344
Gene: ENSMUSG00000001143

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000125304
AA Change: N162S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000117200
Gene: ENSMUSG00000001143
AA Change: N162S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Lectin_leg-like	48	275	3.2e-88	PFAM
transmembrane domain	313	335	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134594

Predicted Effect

unknown
Transcript: ENSMUST00000192969
AA Change: N41S

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193502

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the L-type lectin group of type 1 membrane proteins, which function in the mammalian early secretory pathway. These proteins contain luminal carbohydrate recognition domains, which display homology to leguminous lectins. Unlike other proteins of the group, which cycle in the early secretory pathway and are predominantly associated with post endoplasmic reticulum membranes, the protein encoded by this gene is a non-cycling resident protein of the ER, where it functions as a cargo receptor for glycoproteins. It is proposed to regulate exchange of folded proteins for transport to the Golgi and exchange of misfolded glycoproteins for transport to the ubiquitin-proteasome pathway. [provided by RefSeq, Apr 2016]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc3	A	G	11: 94,264,824 (GRCm39)	Y175H	probably damaging	Het
Agtpbp1	A	T	13: 59,598,114 (GRCm39)	V1165D	possibly damaging	Het
Ahsg	A	G	16: 22,717,611 (GRCm39)	D224G	probably benign	Het
Akap11	T	C	14: 78,749,861 (GRCm39)	D842G	possibly damaging	Het
Anln	T	C	9: 22,245,413 (GRCm39)	N186D	possibly damaging	Het
Aqr	A	G	2: 113,940,445 (GRCm39)	Y1234H	probably damaging	Het
Ccdc162	A	G	10: 41,570,464 (GRCm39)	F7S	probably benign	Het
Cltc	T	C	11: 86,596,084 (GRCm39)	Y1222C	probably damaging	Het
Coro2a	C	T	4: 46,562,912 (GRCm39)	V81I	probably damaging	Het
Cpa5	T	C	6: 30,613,984 (GRCm39)	V42A	probably damaging	Het
D2hgdh	A	G	1: 93,754,177 (GRCm39)	Y50C	probably damaging	Het
Ddx6	A	G	9: 44,540,049 (GRCm39)	N326D	probably damaging	Het
Dedd2	A	G	7: 24,903,215 (GRCm39)	L248P	possibly damaging	Het
Frem3	T	A	8: 81,341,832 (GRCm39)	I1375N	probably damaging	Het
Gm12185	T	C	11: 48,807,002 (GRCm39)	N63S	probably benign	Het
H2-Aa	A	G	17: 34,502,172 (GRCm39)	S250P	probably damaging	Het
Hbs1l	T	C	10: 21,243,656 (GRCm39)	S667P	possibly damaging	Het
Hc	T	A	2: 34,896,285 (GRCm39)		probably null	Het
Hoxd4	A	T	2: 74,557,729 (GRCm39)	Y36F	possibly damaging	Het
Ifi207	A	G	1: 173,555,111 (GRCm39)	V864A	probably damaging	Het
Igsf10	T	A	3: 59,235,928 (GRCm39)	T1418S	possibly damaging	Het
Klhl41	T	C	2: 69,510,176 (GRCm39)		probably null	Het
Lrr1	T	G	12: 69,215,655 (GRCm39)	V9G	probably damaging	Het
Marchf5	T	C	19: 37,198,140 (GRCm39)	I127T	probably damaging	Het
Med12l	T	C	3: 59,163,423 (GRCm39)	L1350P	probably damaging	Het
Mmp25	G	A	17: 23,849,768 (GRCm39)	A541V	possibly damaging	Het
Myh10	T	A	11: 68,636,241 (GRCm39)	I210N	probably benign	Het
Myo5c	A	G	9: 75,182,836 (GRCm39)	N825S	probably benign	Het
Nav3	T	C	10: 109,524,694 (GRCm39)	T2312A	probably damaging	Het
Ndrg4	G	T	8: 96,436,396 (GRCm39)	R208L	probably damaging	Het
Nell2	G	A	15: 95,244,706 (GRCm39)	P464S	probably damaging	Het
Nrxn3	T	A	12: 90,299,011 (GRCm39)	Y374N	probably damaging	Het
Oprd1	A	C	4: 131,841,365 (GRCm39)	C198G	possibly damaging	Het
Pik3ca	T	C	3: 32,494,863 (GRCm39)		probably null	Het
Plin4	T	G	17: 56,411,787 (GRCm39)	D748A	possibly damaging	Het
Pramel23	T	G	4: 143,425,722 (GRCm39)	T74P	possibly damaging	Het
Prkg2	T	G	5: 99,082,223 (GRCm39)	K52Q	probably benign	Het
Ptprk	A	T	10: 28,442,669 (GRCm39)	E890D	probably damaging	Het
Rab27b	T	C	18: 70,122,659 (GRCm39)	D100G	probably damaging	Het
Ranbp6	T	C	19: 29,790,026 (GRCm39)	T109A	probably benign	Het
Rarb	T	A	14: 16,818,819 (GRCm38)	M17L	probably benign	Het
Rasgrf2	T	C	13: 92,167,293 (GRCm39)	H260R	probably damaging	Het
Rec8	T	A	14: 55,856,636 (GRCm39)	D109E	probably damaging	Het
Scd4	C	A	19: 44,327,398 (GRCm39)	S158*	probably null	Het
Scn7a	T	A	2: 66,505,870 (GRCm39)	E1673V	possibly damaging	Het
Sit1	A	T	4: 43,482,651 (GRCm39)	D169E	possibly damaging	Het
Slc16a14	G	T	1: 84,885,130 (GRCm39)	Q470K	probably benign	Het
Slc43a2	T	A	11: 75,457,900 (GRCm39)	C392S	possibly damaging	Het
Smg1	A	G	7: 117,765,310 (GRCm39)		probably benign	Het
Sstr2	A	T	11: 113,515,932 (GRCm39)	I284F	probably damaging	Het
Tep1	C	T	14: 51,082,970 (GRCm39)	V1013M	probably damaging	Het
Tmem120b	T	G	5: 123,253,763 (GRCm39)	L232R	probably damaging	Het
Tmem9b	C	A	7: 109,344,612 (GRCm39)	V75F	probably damaging	Het
Trappc3	A	G	4: 126,167,731 (GRCm39)	S97G	probably damaging	Het
Ube3c	T	C	5: 29,795,829 (GRCm39)	F73L	probably damaging	Het
Vmn1r127	C	A	7: 21,052,930 (GRCm39)	C286F	probably benign	Het
Vmn1r44	T	C	6: 89,870,652 (GRCm39)	S133P	probably benign	Het
Vps8	C	T	16: 21,378,099 (GRCm39)	Q635*	probably null	Het
Vwa8	A	G	14: 79,324,252 (GRCm39)	E1185G	possibly damaging	Het
Zfp354c	G	A	11: 50,706,274 (GRCm39)	T267I	probably benign	Het

Other mutations in Lman2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Lman2l	APN	1	36,477,915 (GRCm39)	critical splice acceptor site	probably null
IGL02301:Lman2l	APN	1	36,482,624 (GRCm39)	missense	probably damaging	1.00
IGL03288:Lman2l	APN	1	36,482,628 (GRCm39)	missense	probably damaging	0.98
IGL03295:Lman2l	APN	1	36,477,892 (GRCm39)	missense	probably damaging	1.00
R0128:Lman2l	UTSW	1	36,463,945 (GRCm39)	nonsense	probably null
R0130:Lman2l	UTSW	1	36,463,945 (GRCm39)	nonsense	probably null
R0981:Lman2l	UTSW	1	36,484,314 (GRCm39)	start codon destroyed	unknown
R2010:Lman2l	UTSW	1	36,484,262 (GRCm39)	nonsense	probably null
R2039:Lman2l	UTSW	1	36,467,535 (GRCm39)	missense	probably damaging	1.00
R2343:Lman2l	UTSW	1	36,467,190 (GRCm39)	missense	possibly damaging	0.90
R4195:Lman2l	UTSW	1	36,464,022 (GRCm39)	missense	probably damaging	0.98
R4394:Lman2l	UTSW	1	36,478,804 (GRCm39)	missense	probably damaging	1.00
R4526:Lman2l	UTSW	1	36,477,844 (GRCm39)	missense	probably damaging	0.98
R5747:Lman2l	UTSW	1	36,464,038 (GRCm39)	missense	possibly damaging	0.90
R6156:Lman2l	UTSW	1	36,477,907 (GRCm39)	missense	probably damaging	1.00
R7013:Lman2l	UTSW	1	36,482,599 (GRCm39)	unclassified	probably benign
R9189:Lman2l	UTSW	1	36,478,771 (GRCm39)	missense	probably damaging	1.00
R9356:Lman2l	UTSW	1	36,467,415 (GRCm39)	missense	probably damaging	1.00
R9577:Lman2l	UTSW	1	36,467,490 (GRCm39)	missense	probably damaging	1.00
Z1176:Lman2l	UTSW	1	36,467,457 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGACTGCTGGGATCACAGG -3'
(R):5'- CAGAAATACCTGGTGCCATTTG -3'

Sequencing Primer
(F):5'- TGCTGGGATCACAGGCAGTTC -3'
(R):5'- GGTGCCATTTGAATATCACCCTG -3'

Posted On

2018-03-15