Incidental Mutation 'R5231:Olfr1499'
ID398575
Institutional Source Beutler Lab
Gene Symbol Olfr1499
Ensembl Gene ENSMUSG00000045395
Gene Nameolfactory receptor 1499
SynonymsMOR211-2, GA_x6K02T2RE5P-4147744-4146800
MMRRC Submission 042803-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R5231 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13814275-13819447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13815347 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 81 (I81N)
Ref Sequence ENSEMBL: ENSMUSP00000150330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055672] [ENSMUST00000216659]
Predicted Effect probably damaging
Transcript: ENSMUST00000055672
AA Change: I81N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059747
Gene: ENSMUSG00000045395
AA Change: I81N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.6e-44 PFAM
Pfam:7tm_1 41 290 1.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216659
AA Change: I81N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,683,951 H716L possibly damaging Het
9130019O22Rik T C 7: 127,385,414 Y172C probably damaging Het
Adat3 T C 10: 80,606,426 S33P possibly damaging Het
Bche G A 3: 73,700,861 P411S probably benign Het
Chil3 A G 3: 106,155,729 S182P probably damaging Het
Col6a4 T C 9: 106,025,531 E1653G probably damaging Het
Csk G T 9: 57,630,378 H84Q probably damaging Het
Csmd2 A G 4: 128,546,049 T3099A probably benign Het
Deup1 G T 9: 15,575,199 A395E probably damaging Het
Frem2 T C 3: 53,522,295 Y2778C probably damaging Het
Gm10020 T C 15: 52,478,044 noncoding transcript Het
Igfn1 T C 1: 135,966,736 T2031A probably benign Het
Ighv1-53 C A 12: 115,158,605 S50I probably benign Het
Ighv1-62-3 A T 12: 115,461,051 M100K possibly damaging Het
Igkv2-109 T A 6: 68,302,445 F3I probably benign Het
Isl1 T C 13: 116,301,657 D296G probably benign Het
Klk1b16 T A 7: 44,137,347 L10Q probably damaging Het
Kmt2c A T 5: 25,315,473 S1880T possibly damaging Het
Lhcgr T A 17: 88,755,611 N211I probably damaging Het
Ltb C T 17: 35,195,826 L201F probably damaging Het
Mfsd2a A G 4: 122,959,301 F64S possibly damaging Het
Mmp10 T C 9: 7,502,500 probably null Het
Mycbp2 A C 14: 103,346,214 probably null Het
Olfr181 T C 16: 58,925,714 I286V possibly damaging Het
Olfr394 C A 11: 73,887,955 C139F probably damaging Het
Olfr589 A T 7: 103,154,968 F260I probably damaging Het
Peg10 C T 6: 4,756,939 probably benign Het
Plscr1 C A 9: 92,266,731 P208H probably damaging Het
Rhot1 T C 11: 80,227,334 probably null Het
Smarcc2 T C 10: 128,461,352 Y38H probably damaging Het
Stat2 T C 10: 128,281,242 probably null Het
Trip11 T C 12: 101,885,601 K735E probably damaging Het
Ttll1 T A 15: 83,489,466 probably null Het
Vmn2r37 C A 7: 9,206,595 L639F possibly damaging Het
Vmn2r60 A T 7: 42,137,024 Q417L possibly damaging Het
Vps8 A T 16: 21,576,725 D1255V probably damaging Het
Zfp354b A C 11: 50,923,090 I336S probably benign Het
Other mutations in Olfr1499
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr1499 APN 19 13815302 missense probably benign 0.09
IGL01844:Olfr1499 APN 19 13814816 missense possibly damaging 0.95
IGL03102:Olfr1499 APN 19 13815371 missense probably damaging 1.00
IGL03352:Olfr1499 APN 19 13814928 missense probably damaging 1.00
R0218:Olfr1499 UTSW 19 13814978 missense probably benign 0.19
R0490:Olfr1499 UTSW 19 13814855 missense probably damaging 1.00
R0682:Olfr1499 UTSW 19 13815137 missense possibly damaging 0.94
R1301:Olfr1499 UTSW 19 13815362 missense probably damaging 1.00
R1328:Olfr1499 UTSW 19 13815536 missense probably benign 0.01
R2100:Olfr1499 UTSW 19 13815236 missense possibly damaging 0.95
R3701:Olfr1499 UTSW 19 13815348 missense probably benign 0.03
R4563:Olfr1499 UTSW 19 13815282 missense probably benign 0.01
R4709:Olfr1499 UTSW 19 13815450 missense possibly damaging 0.94
R5301:Olfr1499 UTSW 19 13815569 missense probably damaging 0.99
R5343:Olfr1499 UTSW 19 13814960 missense probably damaging 1.00
R6268:Olfr1499 UTSW 19 13815307 nonsense probably null
R6442:Olfr1499 UTSW 19 13815628 start gained probably benign
R7132:Olfr1499 UTSW 19 13815422 missense probably benign 0.09
R7764:Olfr1499 UTSW 19 13814747 missense probably benign 0.01
Z1088:Olfr1499 UTSW 19 13815548 missense probably damaging 1.00
Z1177:Olfr1499 UTSW 19 13815044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCTTTGAATGGACCCAG -3'
(R):5'- TACTGACCATCCAGAGTGGG -3'

Sequencing Primer
(F):5'- GTTCTTTGAATGGACCCAGATAACCC -3'
(R):5'- ATCCAGAGTGGGAGGTTCCTC -3'
Posted On2016-07-06