Incidental Mutation 'R1301:Olfr1499'
ID158395
Institutional Source Beutler Lab
Gene Symbol Olfr1499
Ensembl Gene ENSMUSG00000045395
Gene Nameolfactory receptor 1499
SynonymsMOR211-2, GA_x6K02T2RE5P-4147744-4146800
MMRRC Submission 039367-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R1301 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13814275-13819447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13815362 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 76 (V76D)
Ref Sequence ENSEMBL: ENSMUSP00000150330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055672] [ENSMUST00000216659]
Predicted Effect probably damaging
Transcript: ENSMUST00000055672
AA Change: V76D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059747
Gene: ENSMUSG00000045395
AA Change: V76D

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.6e-44 PFAM
Pfam:7tm_1 41 290 1.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216659
AA Change: V76D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.4481 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.3%
  • 20x: 82.6%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano1 A G 7: 144,633,689 W447R possibly damaging Het
Blm T A 7: 80,455,417 K103* probably null Het
Camta2 A G 11: 70,676,404 I675T probably benign Het
Catsperz G A 19: 6,925,082 R15C probably damaging Het
Chd1l T C 3: 97,603,648 probably benign Het
Corin C A 5: 72,304,933 E844D possibly damaging Het
Cyb5rl T G 4: 107,080,907 M127R probably damaging Het
Dcdc2a A T 13: 25,102,586 N164I possibly damaging Het
Dnah6 A G 6: 73,208,545 probably null Het
Emilin2 T C 17: 71,255,965 probably benign Het
Epb41l2 T A 10: 25,443,902 V211D probably damaging Het
Fbxo47 C T 11: 97,868,601 M166I probably benign Het
Gm13124 T A 4: 144,565,065 I24L probably benign Het
Gm4450 G A 3: 98,446,866 Q106* probably null Het
Golm1 T C 13: 59,638,373 D335G probably damaging Het
Gpn1 T A 5: 31,503,429 M188K probably damaging Het
Gpr84 T A 15: 103,309,219 S144C probably damaging Het
Grm8 G T 6: 27,981,201 Q237K possibly damaging Het
Gsdmd C A 15: 75,867,059 probably null Het
Hmgcr G A 13: 96,659,020 T347I probably damaging Het
Hsd17b7 T A 1: 169,961,205 probably benign Het
Klhl7 T G 5: 24,159,491 W508G probably damaging Het
Lrp2 C A 2: 69,428,604 D4581Y probably damaging Het
Lrrc7 T C 3: 158,135,331 N1357D probably benign Het
Macf1 T C 4: 123,486,658 probably benign Het
Mroh7 T C 4: 106,720,495 T329A probably damaging Het
Mroh9 C T 1: 163,043,983 probably null Het
Mta2 A G 19: 8,949,186 probably benign Het
Myo3a A T 2: 22,267,095 probably benign Het
Nrip2 A G 6: 128,407,389 D153G probably benign Het
Nup133 T C 8: 123,917,417 probably benign Het
Nup210 C T 6: 91,042,347 V259M possibly damaging Het
Olfr1338 C T 4: 118,753,619 M308I probably benign Het
Olfr1466 A T 19: 13,341,847 I30F probably benign Het
Otog C T 7: 46,289,689 R2048C probably damaging Het
Paqr7 T C 4: 134,507,813 L327P probably damaging Het
Parl A G 16: 20,286,926 S249P probably damaging Het
Phc1 A G 6: 122,325,874 I230T probably benign Het
Pitpnm1 T G 19: 4,110,831 probably null Het
Plpp1 A G 13: 112,834,943 Y48C probably damaging Het
Pxdc1 A G 13: 34,628,887 F194L probably benign Het
Rp1 A T 1: 4,345,936 V1651D possibly damaging Het
Serpinb1c T A 13: 32,896,960 R47* probably null Het
Sis T C 3: 72,946,582 T521A possibly damaging Het
Slc16a9 A G 10: 70,282,478 D209G probably benign Het
Slc26a4 A T 12: 31,525,568 C706* probably null Het
Slc37a2 A G 9: 37,236,881 V325A probably benign Het
Speg T A 1: 75,401,501 D784E probably damaging Het
Sycp1 T C 3: 102,920,622 I270V probably benign Het
Tatdn2 T A 6: 113,704,115 F309I probably damaging Het
Tmem206 T C 1: 191,348,435 V284A probably damaging Het
Tmem67 T C 4: 12,089,400 probably benign Het
Trpm1 T A 7: 64,203,053 probably null Het
Wrn T C 8: 33,292,686 R496G probably damaging Het
Zfhx2 A G 14: 55,063,397 V2299A probably benign Het
Zfp819 T A 7: 43,617,100 S260T possibly damaging Het
Other mutations in Olfr1499
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr1499 APN 19 13815302 missense probably benign 0.09
IGL01844:Olfr1499 APN 19 13814816 missense possibly damaging 0.95
IGL03102:Olfr1499 APN 19 13815371 missense probably damaging 1.00
IGL03352:Olfr1499 APN 19 13814928 missense probably damaging 1.00
R0218:Olfr1499 UTSW 19 13814978 missense probably benign 0.19
R0490:Olfr1499 UTSW 19 13814855 missense probably damaging 1.00
R0682:Olfr1499 UTSW 19 13815137 missense possibly damaging 0.94
R1328:Olfr1499 UTSW 19 13815536 missense probably benign 0.01
R2100:Olfr1499 UTSW 19 13815236 missense possibly damaging 0.95
R3701:Olfr1499 UTSW 19 13815348 missense probably benign 0.03
R4563:Olfr1499 UTSW 19 13815282 missense probably benign 0.01
R4709:Olfr1499 UTSW 19 13815450 missense possibly damaging 0.94
R5231:Olfr1499 UTSW 19 13815347 missense probably damaging 0.99
R5301:Olfr1499 UTSW 19 13815569 missense probably damaging 0.99
R5343:Olfr1499 UTSW 19 13814960 missense probably damaging 1.00
R6268:Olfr1499 UTSW 19 13815307 nonsense probably null
R6442:Olfr1499 UTSW 19 13815628 start gained probably benign
R7132:Olfr1499 UTSW 19 13815422 missense probably benign 0.09
R7764:Olfr1499 UTSW 19 13814747 missense probably benign 0.01
R7943:Olfr1499 UTSW 19 13815236 missense probably damaging 0.99
Z1088:Olfr1499 UTSW 19 13815548 missense probably damaging 1.00
Z1177:Olfr1499 UTSW 19 13815044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAAGGTTTTACCTCTGCCACCTG -3'
(R):5'- TGGGCTTTACTGACCATCCAGAGTG -3'

Sequencing Primer
(F):5'- GTTCTTTGAATGGACCCAGATAACC -3'
(R):5'- CATCCAGAGTGGGAGGTTC -3'
Posted On2014-02-18