Incidental Mutation 'R6487:U2surp'
ID517480
Institutional Source Beutler Lab
Gene Symbol U2surp
Ensembl Gene ENSMUSG00000032407
Gene NameU2 snRNP-associated SURP domain containing
Synonyms2610101N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6487 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location95456898-95511996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95477512 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 650 (M650K)
Ref Sequence ENSEMBL: ENSMUSP00000151121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078374] [ENSMUST00000079659] [ENSMUST00000191213] [ENSMUST00000217176]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078374
AA Change: M607K

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077482
Gene: ENSMUSG00000032407
AA Change: M607K

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
coiled coil region 148 186 N/A INTRINSIC
RRM 231 307 1.85e-18 SMART
low complexity region 313 323 N/A INTRINSIC
SWAP 384 438 1.07e-20 SMART
RPR 493 632 1.42e-41 SMART
internal_repeat_1 648 665 6.09e-7 PROSPERO
internal_repeat_1 678 698 6.09e-7 PROSPERO
coiled coil region 742 769 N/A INTRINSIC
cwf21 792 843 6.31e-17 SMART
low complexity region 881 933 N/A INTRINSIC
low complexity region 939 985 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079659
AA Change: M651K

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078602
Gene: ENSMUSG00000032407
AA Change: M651K

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 1.85e-18 SMART
low complexity region 357 367 N/A INTRINSIC
SWAP 428 482 1.07e-20 SMART
RPR 537 676 1.42e-41 SMART
internal_repeat_1 692 709 1.14e-6 PROSPERO
internal_repeat_1 722 742 1.14e-6 PROSPERO
coiled coil region 786 813 N/A INTRINSIC
cwf21 836 887 6.31e-17 SMART
low complexity region 925 977 N/A INTRINSIC
low complexity region 983 1029 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186139
Predicted Effect probably benign
Transcript: ENSMUST00000191213
SMART Domains Protein: ENSMUSP00000140614
Gene: ENSMUSG00000032407

DomainStartEndE-ValueType
low complexity region 18 27 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
coiled coil region 192 230 N/A INTRINSIC
RRM 275 351 7.8e-21 SMART
low complexity region 357 367 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217176
AA Change: M650K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6958 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,397,472 Y963H possibly damaging Het
Alpk2 T C 18: 65,266,183 N2108S possibly damaging Het
Atp13a1 T C 8: 69,799,878 S641P probably damaging Het
BC048403 T C 10: 121,745,541 L13P probably damaging Het
Bptf C T 11: 107,077,726 V981I probably damaging Het
Cntrl A T 2: 35,122,682 K277N possibly damaging Het
Cops5 T C 1: 10,037,779 T12A probably benign Het
Cyp2c37 A T 19: 39,994,581 T205S probably benign Het
Dnah7c T C 1: 46,769,124 V3485A probably damaging Het
Ifna6 A T 4: 88,827,506 N31Y probably damaging Het
Irgm1 C A 11: 48,865,950 A345S probably benign Het
Med13 T C 11: 86,331,150 T218A probably damaging Het
Mroh2b G T 15: 4,947,239 D1225Y probably damaging Het
Npepl1 A G 2: 174,111,732 E152G probably benign Het
Olfr1170 A G 2: 88,224,526 S169P possibly damaging Het
Olfr1260 A T 2: 89,977,838 D20V probably benign Het
Olfr1282 T C 2: 111,335,667 D137G probably benign Het
Olfr196 A T 16: 59,168,173 probably null Het
Olfr921 A G 9: 38,775,435 Y60C probably damaging Het
Oog2 A G 4: 144,196,485 E440G possibly damaging Het
Ranbp2 T C 10: 58,485,741 V2620A probably benign Het
Rims4 A T 2: 163,864,897 F187Y possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Shisa9 C T 16: 12,244,611 T232I probably benign Het
Slf1 A T 13: 77,066,617 I650N probably damaging Het
Tpst2 T C 5: 112,308,123 L176P probably damaging Het
Vmn1r17 A T 6: 57,361,224 M3K possibly damaging Het
Vmn1r55 A G 7: 5,146,555 S290P probably benign Het
Vmn2r102 G A 17: 19,677,907 E395K probably damaging Het
Wapl T A 14: 34,692,292 H370Q probably damaging Het
Xab2 T C 8: 3,613,879 S347G possibly damaging Het
Other mutations in U2surp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:U2surp APN 9 95461524 utr 3 prime probably benign
IGL01122:U2surp APN 9 95490234 missense probably benign 0.02
IGL01985:U2surp APN 9 95490226 missense probably damaging 1.00
IGL01992:U2surp APN 9 95464419 missense possibly damaging 0.46
IGL01992:U2surp APN 9 95482181 missense probably damaging 0.99
IGL02300:U2surp APN 9 95488770 missense probably damaging 1.00
IGL02491:U2surp APN 9 95490220 missense probably damaging 0.98
IGL02503:U2surp APN 9 95502569 missense probably benign 0.03
IGL02615:U2surp APN 9 95493231 missense probably benign 0.00
IGL02628:U2surp APN 9 95472090 missense possibly damaging 0.89
IGL02682:U2surp APN 9 95481651 critical splice donor site probably null
IGL02721:U2surp APN 9 95474435 missense probably benign 0.10
IGL03200:U2surp APN 9 95491391 nonsense probably null
coup UTSW 9 95477512 missense probably damaging 1.00
R0095:U2surp UTSW 9 95500684 splice site probably null
R0373:U2surp UTSW 9 95484443 missense probably benign 0.08
R0376:U2surp UTSW 9 95484443 missense probably benign 0.08
R0377:U2surp UTSW 9 95484443 missense probably benign 0.08
R0416:U2surp UTSW 9 95485607 missense probably damaging 1.00
R0682:U2surp UTSW 9 95484443 missense probably benign 0.08
R0948:U2surp UTSW 9 95461497 utr 3 prime probably benign
R1420:U2surp UTSW 9 95462803 missense probably benign 0.33
R1474:U2surp UTSW 9 95493198 missense possibly damaging 0.49
R1555:U2surp UTSW 9 95466577 missense probably damaging 1.00
R1597:U2surp UTSW 9 95481740 splice site probably benign
R1638:U2surp UTSW 9 95484227 missense possibly damaging 0.95
R1693:U2surp UTSW 9 95511860 start codon destroyed probably null 0.53
R1851:U2surp UTSW 9 95482097 nonsense probably null
R2271:U2surp UTSW 9 95491420 missense possibly damaging 0.80
R2679:U2surp UTSW 9 95476232 missense possibly damaging 0.82
R2851:U2surp UTSW 9 95500682 splice site probably null
R3769:U2surp UTSW 9 95493697 splice site probably benign
R4596:U2surp UTSW 9 95485628 missense probably damaging 1.00
R4672:U2surp UTSW 9 95493145 missense possibly damaging 0.83
R4763:U2surp UTSW 9 95511791 intron probably benign
R4995:U2surp UTSW 9 95462794 utr 3 prime probably benign
R5805:U2surp UTSW 9 95479304 missense possibly damaging 0.51
R6006:U2surp UTSW 9 95479307 missense probably damaging 0.96
R6249:U2surp UTSW 9 95500816 missense probably benign 0.07
R6260:U2surp UTSW 9 95476157 missense probably damaging 0.99
R6378:U2surp UTSW 9 95491421 missense probably benign 0.41
R6585:U2surp UTSW 9 95472071 missense probably damaging 1.00
R6721:U2surp UTSW 9 95491104 missense probably damaging 0.99
R6760:U2surp UTSW 9 95493711 missense probably benign 0.27
R7065:U2surp UTSW 9 95485659 missense probably benign 0.01
R7167:U2surp UTSW 9 95481673 missense probably damaging 0.98
R7219:U2surp UTSW 9 95490162 nonsense probably null
R7232:U2surp UTSW 9 95493717 missense probably benign 0.03
R7460:U2surp UTSW 9 95462824 missense unknown
R7547:U2surp UTSW 9 95479349 missense possibly damaging 0.94
X0018:U2surp UTSW 9 95475288 missense probably benign 0.14
X0018:U2surp UTSW 9 95485597 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGTCTTATGTAACACTGACTCTTG -3'
(R):5'- CCCAGCATTTATGTTTACTTGGAAG -3'

Sequencing Primer
(F):5'- GTACAGAATACCTACCTCTGT -3'
(R):5'- GCATTTATGTTTACTTGGAAGATAGC -3'
Posted On2018-05-21