Incidental Mutation 'R1972:Lgmn'
ID221125
Institutional Source Beutler Lab
Gene Symbol Lgmn
Ensembl Gene ENSMUSG00000021190
Gene Namelegumain
SynonymsPrsc1, preprolegumain, AEP
MMRRC Submission 039985-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1972 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102394084-102439813 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 102395821 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021607] [ENSMUST00000056950] [ENSMUST00000110020] [ENSMUST00000133820]
Predicted Effect probably benign
Transcript: ENSMUST00000021607
SMART Domains Protein: ENSMUSP00000021607
Gene: ENSMUSG00000021190

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056950
SMART Domains Protein: ENSMUSP00000060771
Gene: ENSMUSG00000044456

DomainStartEndE-ValueType
low complexity region 20 32 N/A INTRINSIC
SH2 61 149 1.89e-2 SMART
low complexity region 254 311 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 448 469 N/A INTRINSIC
low complexity region 514 523 N/A INTRINSIC
low complexity region 579 594 N/A INTRINSIC
low complexity region 714 728 N/A INTRINSIC
VPS9 736 852 5.75e-38 SMART
RA 873 960 3.5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110020
SMART Domains Protein: ENSMUSP00000105647
Gene: ENSMUSG00000021190

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133820
SMART Domains Protein: ENSMUSP00000122646
Gene: ENSMUSG00000044456

DomainStartEndE-ValueType
Blast:SH2 1 69 3e-39 BLAST
SCOP:d1a81a2 3 77 2e-4 SMART
low complexity region 174 231 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 278 300 N/A INTRINSIC
low complexity region 368 389 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
low complexity region 634 648 N/A INTRINSIC
VPS9 656 772 5.75e-38 SMART
RA 793 880 3.5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146499
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: This gene encodes a member of the cysteine peptidase family C13 that plays an important role in the endosome/lysosomal degradation system. The encoded inactive preproprotein undergoes autocatalytic removal of the C-terminal inhibitory propeptide to generate the active endopeptidase that cleaves protein substrates on the C-terminal side of asparagine residues. Mice lacking the encoded protein exhibit defects in the lysosomal processing of proteins resulting in their accumulation in the lysosomes, and develop symptoms resembling hemophagocytic lymphohistiocytosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a null allele exhibit slow postnatal weight gain, develop features of hemophagocytic syndrome, and accumulate giant lysosomes in renal tubule cells. Homozygotes for another null allele display impaired TLR9 signaling in dendritic cells, progressive kidney pathology, and proteinuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,990,418 probably benign Het
Bbs2 A G 8: 94,081,177 probably benign Het
Bcl9 A C 3: 97,207,202 D1035E probably damaging Het
Bmpr2 A G 1: 59,813,603 E31G possibly damaging Het
Borcs5 A G 6: 134,710,174 D164G probably damaging Het
Cap2 A G 13: 46,637,899 R181G probably damaging Het
Ccdc113 A T 8: 95,538,246 H128L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chat C T 14: 32,424,191 V342I probably benign Het
Chrm4 C T 2: 91,927,493 A82V probably benign Het
Cyp2d22 A T 15: 82,375,827 M52K probably benign Het
Dennd2c T C 3: 103,131,698 V54A probably benign Het
Dgka C T 10: 128,720,466 G717D probably damaging Het
Dnah1 C T 14: 31,265,391 W3550* probably null Het
Eif2ak1 A G 5: 143,884,714 T283A probably benign Het
Fam189a1 A T 7: 64,775,768 I192N possibly damaging Het
Fcgbp A T 7: 28,094,192 Y1173F probably benign Het
Flt1 G A 5: 147,655,093 probably benign Het
Gpr149 T C 3: 62,530,795 K647R probably benign Het
Gsdma2 T C 11: 98,650,918 V157A probably benign Het
Heatr4 T A 12: 83,955,020 I884F probably damaging Het
Il17ra A G 6: 120,482,216 E776G probably benign Het
Inpp5d T C 1: 87,676,314 S235P probably benign Het
Iqgap3 T A 3: 88,083,928 probably null Het
Isoc2a T A 7: 4,892,087 D171E probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Kcnk12 T C 17: 87,797,132 D108G possibly damaging Het
Klra9 A T 6: 130,182,382 probably null Het
Morf4l1 A T 9: 90,095,214 probably benign Het
Mthfr T C 4: 148,051,927 I380T probably damaging Het
Mybpc1 T C 10: 88,551,542 I436V probably benign Het
Naip5 A G 13: 100,212,770 V1350A probably damaging Het
Neil2 A T 14: 63,186,077 C36S possibly damaging Het
Nlrx1 A G 9: 44,253,456 V897A probably benign Het
Nod2 A T 8: 88,652,873 M8L probably damaging Het
Nop2 A G 6: 125,134,639 T112A probably benign Het
Nrap T A 19: 56,357,353 T608S probably damaging Het
Nuak2 A T 1: 132,330,602 H257L probably damaging Het
Olfr1218 A T 2: 89,054,547 M293K probably benign Het
Olfr1475 T C 19: 13,479,694 N168S probably benign Het
Olfr209 A T 16: 59,362,113 V35D probably damaging Het
Olfr417 T C 1: 174,369,570 F218L probably benign Het
Olfr671 T C 7: 104,975,899 I33V possibly damaging Het
Olfr693 T C 7: 106,678,219 D89G probably benign Het
Olfr889 T A 9: 38,116,567 M257K possibly damaging Het
Pde1a T C 2: 79,865,721 E358G probably damaging Het
Pdlim1 A T 19: 40,223,137 S237R probably damaging Het
Pithd1 T C 4: 135,987,029 D36G probably damaging Het
Ppp2r3a A G 9: 101,211,777 F449S probably benign Het
Prr11 G A 11: 87,098,754 R264C possibly damaging Het
Rbm43 A T 2: 51,925,536 H224Q probably benign Het
Rfx5 C T 3: 94,957,292 L250F probably damaging Het
Rgs22 T A 15: 36,103,836 I160L probably benign Het
Rorb T A 19: 18,952,203 Q393H probably damaging Het
Rpl13a T A 7: 45,125,995 K368* probably null Het
Scaf8 T G 17: 3,169,371 S276R unknown Het
Scube2 A T 7: 109,809,214 N675K probably benign Het
Sec22c A T 9: 121,688,254 M126K possibly damaging Het
Serpinb11 T C 1: 107,369,480 F29L probably damaging Het
Sis A G 3: 72,921,004 F1217S probably damaging Het
Slc18a2 A G 19: 59,274,653 D294G possibly damaging Het
Slc9c1 A G 16: 45,593,472 T988A possibly damaging Het
Smndc1 A C 19: 53,383,555 probably null Het
Sned1 G A 1: 93,265,073 G361S probably damaging Het
Spatc1 A T 15: 76,284,875 probably null Het
Stab2 A T 10: 86,960,316 C356S probably damaging Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tbc1d30 A T 10: 121,306,230 probably null Het
Tenm3 T C 8: 48,228,591 E2668G probably damaging Het
Tigar A G 6: 127,087,926 V253A possibly damaging Het
Tmc2 T A 2: 130,214,664 probably benign Het
Ttc26 C A 6: 38,410,803 N396K probably benign Het
Ugt1a10 A T 1: 88,056,047 Y189F probably damaging Het
Vmn2r82 A G 10: 79,378,846 D221G probably damaging Het
Xkr5 C T 8: 18,941,981 V131M probably damaging Het
Other mutations in Lgmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Lgmn APN 12 102398176 splice site probably benign
IGL02069:Lgmn APN 12 102404299 missense possibly damaging 0.92
IGL02150:Lgmn APN 12 102395727 missense possibly damaging 0.80
IGL02228:Lgmn APN 12 102395714 missense probably benign 0.04
IGL02637:Lgmn APN 12 102400226 missense probably damaging 0.98
Getz UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R0988:Lgmn UTSW 12 102398277 missense probably damaging 0.99
R1451:Lgmn UTSW 12 102405892 splice site probably benign
R1568:Lgmn UTSW 12 102394609 missense possibly damaging 0.95
R1944:Lgmn UTSW 12 102401924 missense probably damaging 1.00
R2133:Lgmn UTSW 12 102394908 missense probably damaging 1.00
R2298:Lgmn UTSW 12 102395678 missense probably damaging 0.99
R3846:Lgmn UTSW 12 102404329 missense possibly damaging 0.87
R4610:Lgmn UTSW 12 102400124 splice site probably benign
R4788:Lgmn UTSW 12 102402677 missense probably benign 0.11
R5050:Lgmn UTSW 12 102403421 splice site probably null
R5708:Lgmn UTSW 12 102404328 missense possibly damaging 0.87
R5969:Lgmn UTSW 12 102405827 missense probably damaging 1.00
R6090:Lgmn UTSW 12 102400154 missense probably damaging 1.00
R6420:Lgmn UTSW 12 102423719 nonsense probably null
R6496:Lgmn UTSW 12 102398239 missense probably benign 0.01
R6592:Lgmn UTSW 12 102404270 missense probably damaging 1.00
R6659:Lgmn UTSW 12 102402692 missense probably benign 0.03
R7063:Lgmn UTSW 12 102402678 missense probably damaging 1.00
R7336:Lgmn UTSW 12 102423739 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACATCTCAGATGCAGGAGACC -3'
(R):5'- CTTTCCAGTGTCACAGAAACC -3'

Sequencing Primer
(F):5'- AGACCTGAGGACCCTAGCTG -3'
(R):5'- CAAACACATACCTAGCATCTCTCTTG -3'
Posted On2014-08-25