Incidental Mutation 'R6618:Barx2'
ID524212
Institutional Source Beutler Lab
Gene Symbol Barx2
Ensembl Gene ENSMUSG00000032033
Gene NameBarH-like homeobox 2
Synonyms2310006E12Rik, Barx2b
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.678) question?
Stock #R6618 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location31846044-31913462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31846872 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 257 (L257F)
Ref Sequence ENSEMBL: ENSMUSP00000112314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116615]
Predicted Effect probably benign
Transcript: ENSMUST00000116615
AA Change: L257F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112314
Gene: ENSMUSG00000032033
AA Change: L257F

DomainStartEndE-ValueType
low complexity region 103 113 N/A INTRINSIC
HOX 137 199 3.2e-25 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 268 283 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeobox transcription factor family. A highly related protein in mouse has been shown to influence cellular processes that control cell adhesion and remodeling of the actin cytoskeleton in myoblast fusion and chondrogenesis. The encoded protein may also play a role in cancer progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted gene deletion exhibit short whiskers at birth, defective juvenile hair follicle remodeling, and short adult hair. Fifty percent of homozygotes are born with open eyelids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp1b2 T C 11: 69,603,463 D68G probably damaging Het
Bbx C G 16: 50,266,263 W90S probably damaging Het
Bmp1 T A 14: 70,491,368 D588V probably damaging Het
Caskin2 C T 11: 115,800,029 M1188I possibly damaging Het
Ccdc180 T A 4: 45,950,708 I1651N probably damaging Het
Cr2 T C 1: 195,157,379 D580G probably damaging Het
Crebbp C T 16: 4,119,806 A698T possibly damaging Het
Fam166a C A 2: 25,220,623 L148M probably benign Het
Fam204a T C 19: 60,220,637 probably null Het
Fam71b A G 11: 46,407,299 T477A probably damaging Het
Fam83h T C 15: 76,003,511 D659G probably damaging Het
Hells G T 19: 38,957,084 R589L probably benign Het
Helz A G 11: 107,599,150 T144A probably benign Het
Il1r1 T A 1: 40,300,811 V258D probably damaging Het
Isoc2a A T 7: 4,895,326 I183F probably benign Het
Kat2a G T 11: 100,712,370 probably benign Het
Klf9 A G 19: 23,164,871 M232V probably benign Het
Lars G T 18: 42,244,908 S147R possibly damaging Het
Mfsd7a G T 5: 108,443,098 T400K probably benign Het
Mkrn3 A G 7: 62,419,033 F337L probably benign Het
Mrc2 A T 11: 105,349,882 N1466I probably damaging Het
Myo5c G A 9: 75,275,637 probably null Het
Pigs T C 11: 78,341,230 L396P probably damaging Het
Prkcb G A 7: 122,627,663 R624Q probably benign Het
R3hdm1 T C 1: 128,193,565 S269P probably benign Het
Racgap1 A T 15: 99,623,994 I505K probably damaging Het
Ralgds T A 2: 28,550,511 D777E probably benign Het
Rdh14 A G 12: 10,395,123 I325V probably benign Het
Rpn2 T A 2: 157,321,861 H624Q probably benign Het
Scarb1 C T 5: 125,304,330 S50N probably damaging Het
Shmt1 T C 11: 60,792,946 probably null Het
Smim24 A G 10: 81,394,132 N27S possibly damaging Het
Snx13 A G 12: 35,112,445 D550G probably damaging Het
Tnfsf18 T A 1: 161,494,780 L23* probably null Het
Trpc3 T A 3: 36,640,695 K703N possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Zfy2 A G Y: 2,121,477 S139P probably benign Homo
Other mutations in Barx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Barx2 APN 9 31846845 missense unknown
IGL02045:Barx2 APN 9 31858798 missense probably damaging 1.00
IGL03341:Barx2 APN 9 31858794 missense probably damaging 1.00
R1401:Barx2 UTSW 9 31859031 missense probably damaging 1.00
R1982:Barx2 UTSW 9 31913012 missense probably damaging 1.00
R2436:Barx2 UTSW 9 31913087 missense probably damaging 0.99
R4543:Barx2 UTSW 9 31846796 missense unknown
R4804:Barx2 UTSW 9 31846812 missense unknown
R5399:Barx2 UTSW 9 31854111 critical splice donor site probably null
R5436:Barx2 UTSW 9 31912989 missense probably damaging 1.00
R5700:Barx2 UTSW 9 31858765 missense probably damaging 1.00
R6036:Barx2 UTSW 9 31913008 missense probably damaging 1.00
R6036:Barx2 UTSW 9 31913008 missense probably damaging 1.00
R6042:Barx2 UTSW 9 31846903 missense probably benign 0.35
R6533:Barx2 UTSW 9 31912979 missense probably damaging 1.00
R8242:Barx2 UTSW 9 31912931 missense probably damaging 1.00
R8307:Barx2 UTSW 9 31859011 missense probably damaging 1.00
R8507:Barx2 UTSW 9 31859013 missense probably damaging 1.00
Z1088:Barx2 UTSW 9 31846866 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GCTTCCGATGAAAATGACGCTG -3'
(R):5'- TCCTTAAAGGTGGACAGGAAGC -3'

Sequencing Primer
(F):5'- ACCCACGTTACTAGTCTTTAGAGG -3'
(R):5'- GTGGACAGGAAGCACCCAC -3'
Posted On2018-06-22