Incidental Mutation 'R6621:Cpt1a'
ID524477
Institutional Source Beutler Lab
Gene Symbol Cpt1a
Ensembl Gene ENSMUSG00000024900
Gene Namecarnitine palmitoyltransferase 1a, liver
SynonymsL-CPT I, CPTI, Cpt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6621 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location3323301-3385732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 3378472 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 615 (F615L)
Ref Sequence ENSEMBL: ENSMUSP00000025835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025835]
Predicted Effect probably damaging
Transcript: ENSMUST00000025835
AA Change: F615L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025835
Gene: ENSMUSG00000024900
AA Change: F615L

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.3e-30 PFAM
transmembrane domain 49 71 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
Pfam:Carn_acyltransf 171 762 6e-186 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mitochondrial oxidation of long-chain fatty acids is initiated by the sequential action of carnitine palmitoyltransferase I (which is located in the outer membrane and is detergent-labile) and carnitine palmitoyltransferase II (which is located in the inner membrane and is detergent-stable), together with a carnitine-acylcarnitine translocase. CPT I is the key enzyme in the carnitine-dependent transport across the mitochondrial inner membrane and its deficiency results in a decreased rate of fatty acid beta-oxidation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous null mice display decreased serum glucose and increased serum free fatty acid levels after fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,423 T30M possibly damaging Het
Abcb8 T C 5: 24,394,510 F8L probably benign Het
Akap13 G T 7: 75,569,981 C44F probably damaging Het
Ankrd34a A G 3: 96,598,215 N245S possibly damaging Het
Ccdc186 T C 19: 56,813,487 D66G probably benign Het
Chat C T 14: 32,419,013 A476T probably damaging Het
Cpsf1 T C 15: 76,603,519 D100G probably damaging Het
Dpp4 T A 2: 62,352,140 D599V probably damaging Het
Dpysl5 T C 5: 30,784,469 probably null Het
Fam234a A G 17: 26,213,881 L460P probably damaging Het
Fsip2 T G 2: 82,989,814 V5297G possibly damaging Het
Gm28363 A G 1: 117,727,357 D102G probably benign Het
Greb1 A G 12: 16,692,717 V1377A probably damaging Het
Hat1 T A 2: 71,421,715 F264I probably benign Het
Kif3a A G 11: 53,579,130 I152M probably damaging Het
Lemd2 T C 17: 27,195,392 S323G probably benign Het
Manea T C 4: 26,340,363 probably null Het
Mcm9 T C 10: 53,563,313 E588G probably damaging Het
Mllt3 T G 4: 87,840,797 K338T possibly damaging Het
Nrxn1 T C 17: 90,162,182 T1324A probably damaging Het
Nudt8 T A 19: 4,001,320 Y64N probably benign Het
Olfr1137 A G 2: 87,711,555 V117A probably benign Het
Olfr1387 A G 11: 49,459,771 I31V probably benign Het
Olfr194 A T 16: 59,119,924 W49R probably benign Het
Olfr25 A T 9: 38,330,462 I289F probably damaging Het
Olfr60 A G 7: 140,345,455 F178S probably damaging Het
Olfr615 A G 7: 103,560,878 T134A possibly damaging Het
Osm T A 11: 4,239,541 D108E probably benign Het
Pde8a A G 7: 81,293,130 probably null Het
Phtf2 T C 5: 20,812,956 probably benign Het
Rnf214 T C 9: 45,896,170 D245G probably damaging Het
Slc10a7 T C 8: 78,515,634 I50T probably damaging Het
Slc5a6 A G 5: 31,040,778 V251A probably damaging Het
Sun3 T A 11: 9,016,242 T320S probably damaging Het
Zfp174 A G 16: 3,847,955 E28G probably damaging Het
Other mutations in Cpt1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Cpt1a APN 19 3366389 missense possibly damaging 0.85
allosouris UTSW 19 3378472 missense probably damaging 1.00
Tyrannosouris UTSW 19 3362156 missense probably damaging 1.00
R0029:Cpt1a UTSW 19 3381674 missense probably benign 0.04
R0029:Cpt1a UTSW 19 3381674 missense probably benign 0.04
R0305:Cpt1a UTSW 19 3378455 missense probably benign
R0963:Cpt1a UTSW 19 3381634 missense probably damaging 1.00
R1511:Cpt1a UTSW 19 3365788 splice site probably benign
R2102:Cpt1a UTSW 19 3371585 missense probably benign 0.25
R3034:Cpt1a UTSW 19 3378390 missense probably damaging 1.00
R3153:Cpt1a UTSW 19 3356430 missense probably damaging 0.99
R5195:Cpt1a UTSW 19 3383800 missense possibly damaging 0.88
R5391:Cpt1a UTSW 19 3349260 missense probably damaging 0.98
R5964:Cpt1a UTSW 19 3365760 missense possibly damaging 0.80
R6031:Cpt1a UTSW 19 3371556 splice site probably null
R6031:Cpt1a UTSW 19 3371556 splice site probably null
R6246:Cpt1a UTSW 19 3376550 missense probably damaging 0.99
R6339:Cpt1a UTSW 19 3362152 missense probably benign 0.27
R6427:Cpt1a UTSW 19 3362156 missense probably damaging 1.00
R6535:Cpt1a UTSW 19 3365788 splice site probably null
R6892:Cpt1a UTSW 19 3371660 missense probably benign 0.00
R7142:Cpt1a UTSW 19 3375100 missense probably benign 0.00
R7385:Cpt1a UTSW 19 3380155 missense probably damaging 0.99
R7908:Cpt1a UTSW 19 3362202 missense probably benign 0.26
R8098:Cpt1a UTSW 19 3370849 missense probably benign
R8362:Cpt1a UTSW 19 3370744 nonsense probably null
R8444:Cpt1a UTSW 19 3381981 missense probably benign
X0019:Cpt1a UTSW 19 3366348 missense probably benign 0.01
Z1177:Cpt1a UTSW 19 3366370 missense probably damaging 1.00
Z1177:Cpt1a UTSW 19 3370727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTTAGATGGCCACTCCC -3'
(R):5'- TTCATGGTCAGCTTCCAGGG -3'

Sequencing Primer
(F):5'- GATGGCCACTCCCACCTGTTAG -3'
(R):5'- TCCAGGGCAGTGACTTTCAAC -3'
Posted On2018-06-22