Incidental Mutation 'R6621:Cpsf1'
ID524464
Institutional Source Beutler Lab
Gene Symbol Cpsf1
Ensembl Gene ENSMUSG00000034022
Gene Namecleavage and polyadenylation specific factor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R6621 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76595803-76607591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76603519 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 100 (D100G)
Ref Sequence ENSEMBL: ENSMUSP00000155308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000230157] [ENSMUST00000231042]
Predicted Effect probably damaging
Transcript: ENSMUST00000071898
AA Change: D100G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022
AA Change: D100G

DomainStartEndE-ValueType
Pfam:MMS1_N 92 684 7.2e-42 PFAM
low complexity region 902 910 N/A INTRINSIC
Pfam:CPSF_A 1071 1407 4.9e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229982
Predicted Effect probably damaging
Transcript: ENSMUST00000230157
AA Change: D100G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231037
Predicted Effect unknown
Transcript: ENSMUST00000231042
AA Change: T75A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231191
Meta Mutation Damage Score 0.2978 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.6%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430548M08Rik C T 8: 120,145,423 T30M possibly damaging Het
Abcb8 T C 5: 24,394,510 F8L probably benign Het
Akap13 G T 7: 75,569,981 C44F probably damaging Het
Ankrd34a A G 3: 96,598,215 N245S possibly damaging Het
Ccdc186 T C 19: 56,813,487 D66G probably benign Het
Chat C T 14: 32,419,013 A476T probably damaging Het
Cpt1a T A 19: 3,378,472 F615L probably damaging Het
Dpp4 T A 2: 62,352,140 D599V probably damaging Het
Dpysl5 T C 5: 30,784,469 probably null Het
Fam234a A G 17: 26,213,881 L460P probably damaging Het
Fsip2 T G 2: 82,989,814 V5297G possibly damaging Het
Gm28363 A G 1: 117,727,357 D102G probably benign Het
Greb1 A G 12: 16,692,717 V1377A probably damaging Het
Hat1 T A 2: 71,421,715 F264I probably benign Het
Kif3a A G 11: 53,579,130 I152M probably damaging Het
Lemd2 T C 17: 27,195,392 S323G probably benign Het
Manea T C 4: 26,340,363 probably null Het
Mcm9 T C 10: 53,563,313 E588G probably damaging Het
Mllt3 T G 4: 87,840,797 K338T possibly damaging Het
Nrxn1 T C 17: 90,162,182 T1324A probably damaging Het
Nudt8 T A 19: 4,001,320 Y64N probably benign Het
Olfr1137 A G 2: 87,711,555 V117A probably benign Het
Olfr1387 A G 11: 49,459,771 I31V probably benign Het
Olfr194 A T 16: 59,119,924 W49R probably benign Het
Olfr25 A T 9: 38,330,462 I289F probably damaging Het
Olfr60 A G 7: 140,345,455 F178S probably damaging Het
Olfr615 A G 7: 103,560,878 T134A possibly damaging Het
Osm T A 11: 4,239,541 D108E probably benign Het
Pde8a A G 7: 81,293,130 probably null Het
Phtf2 T C 5: 20,812,956 probably benign Het
Rnf214 T C 9: 45,896,170 D245G probably damaging Het
Slc10a7 T C 8: 78,515,634 I50T probably damaging Het
Slc5a6 A G 5: 31,040,778 V251A probably damaging Het
Sun3 T A 11: 9,016,242 T320S probably damaging Het
Zfp174 A G 16: 3,847,955 E28G probably damaging Het
Other mutations in Cpsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Cpsf1 APN 15 76600216 missense probably benign 0.27
IGL01013:Cpsf1 APN 15 76599297 nonsense probably null
IGL01599:Cpsf1 APN 15 76596541 missense probably damaging 1.00
IGL02008:Cpsf1 APN 15 76603091 missense probably damaging 1.00
IGL02291:Cpsf1 APN 15 76602821 missense probably damaging 1.00
IGL02901:Cpsf1 APN 15 76599496 nonsense probably null
IGL02929:Cpsf1 APN 15 76602127 critical splice donor site probably null
IGL03402:Cpsf1 APN 15 76596003 splice site probably null
R0005:Cpsf1 UTSW 15 76600680 critical splice donor site probably null
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0487:Cpsf1 UTSW 15 76597002 missense probably damaging 1.00
R0510:Cpsf1 UTSW 15 76603657 intron probably benign
R0630:Cpsf1 UTSW 15 76601971 missense probably damaging 1.00
R0780:Cpsf1 UTSW 15 76600377 missense probably benign 0.17
R1617:Cpsf1 UTSW 15 76602370 nonsense probably null
R1717:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
R1889:Cpsf1 UTSW 15 76602156 missense probably benign 0.06
R1994:Cpsf1 UTSW 15 76603160 missense probably benign 0.03
R2168:Cpsf1 UTSW 15 76603737 missense possibly damaging 0.69
R2359:Cpsf1 UTSW 15 76597673 missense probably benign 0.02
R2697:Cpsf1 UTSW 15 76599329 missense probably damaging 1.00
R2847:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R2848:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R3409:Cpsf1 UTSW 15 76601781 nonsense probably null
R3410:Cpsf1 UTSW 15 76601781 nonsense probably null
R3815:Cpsf1 UTSW 15 76601149 missense probably benign 0.22
R4030:Cpsf1 UTSW 15 76601779 missense possibly damaging 0.96
R4491:Cpsf1 UTSW 15 76597722 missense possibly damaging 0.85
R4615:Cpsf1 UTSW 15 76596937 missense possibly damaging 0.88
R5227:Cpsf1 UTSW 15 76598948 missense probably damaging 1.00
R5353:Cpsf1 UTSW 15 76602571 missense probably damaging 1.00
R5548:Cpsf1 UTSW 15 76597327 missense possibly damaging 0.95
R5552:Cpsf1 UTSW 15 76599646 missense probably benign 0.27
R5746:Cpsf1 UTSW 15 76599837 missense probably benign 0.01
R6319:Cpsf1 UTSW 15 76596967 missense probably damaging 1.00
R6360:Cpsf1 UTSW 15 76597455 frame shift probably null
R6572:Cpsf1 UTSW 15 76597455 frame shift probably null
R6574:Cpsf1 UTSW 15 76597455 frame shift probably null
R6576:Cpsf1 UTSW 15 76597455 frame shift probably null
R6577:Cpsf1 UTSW 15 76597455 frame shift probably null
R6588:Cpsf1 UTSW 15 76596822 missense probably damaging 1.00
R6595:Cpsf1 UTSW 15 76602510 missense probably damaging 1.00
R6880:Cpsf1 UTSW 15 76602539 missense probably benign 0.06
R6954:Cpsf1 UTSW 15 76599496 missense probably damaging 1.00
R7100:Cpsf1 UTSW 15 76596114 missense possibly damaging 0.73
R7255:Cpsf1 UTSW 15 76597543 missense probably damaging 1.00
R7318:Cpsf1 UTSW 15 76597275 nonsense probably null
R7371:Cpsf1 UTSW 15 76600575 missense probably damaging 1.00
R7387:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
R7446:Cpsf1 UTSW 15 76601750 missense probably benign
R7612:Cpsf1 UTSW 15 76597009 missense probably benign 0.00
R7739:Cpsf1 UTSW 15 76600311 missense probably benign 0.00
X0052:Cpsf1 UTSW 15 76596302 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGAGACAGGGTCTTCAGGTC -3'
(R):5'- GAGCACAGGTGAGTATGCAC -3'

Sequencing Primer
(F):5'- CATGAGTGCCTGGGTCATACTC -3'
(R):5'- CACATGATGGGGTGGTGAC -3'
Posted On2018-06-22