Incidental Mutation 'R6637:Adh1'
ID525514
Institutional Source Beutler Lab
Gene Symbol Adh1
Ensembl Gene ENSMUSG00000074207
Gene Namealcohol dehydrogenase 1 (class I)
Synonymsclass I alcohol dehydrogenase, ADH-AA, Adh1tl, Adh-1e, Adh-1t, Adh-1-t, Adh-1, Adh1-t, Adh1-e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6637 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location138260991-138290698 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 138282470 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 98 (C98*)
Ref Sequence ENSEMBL: ENSMUSP00000004232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004232] [ENSMUST00000159159]
Predicted Effect probably null
Transcript: ENSMUST00000004232
AA Change: C98*
SMART Domains Protein: ENSMUSP00000004232
Gene: ENSMUSG00000074207
AA Change: C98*

DomainStartEndE-ValueType
Pfam:ADH_N 34 161 1.3e-25 PFAM
Pfam:ADH_zinc_N 203 337 3.6e-27 PFAM
Pfam:ADH_zinc_N_2 236 369 1.2e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159159
AA Change: V25E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162032
Meta Mutation Damage Score 0.9578 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes class I alcohol dehydrogenase, gamma subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class I alcohol dehydrogenase, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation and plays a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired metabolism of (and sensitivity to) ethanol and retinol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Alms1 A G 6: 85,619,734 H514R possibly damaging Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
Cdh3 G C 8: 106,511,341 V56L probably benign Het
Col3a1 C T 1: 45,347,730 T234I probably damaging Het
Cxadr C T 16: 78,333,503 T186M possibly damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fbxo16 A G 14: 65,295,761 probably null Het
Fign A G 2: 64,027,908 probably benign Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Invs G A 4: 48,416,203 probably null Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Kcnk5 A C 14: 20,144,721 M183R probably null Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Lrrc8b A C 5: 105,480,271 D161A possibly damaging Het
Lrriq1 A T 10: 103,221,432 F169Y probably benign Het
Lsamp T A 16: 41,533,381 V2D possibly damaging Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Olfr1095 T G 2: 86,851,440 K86T probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Spa17 A T 9: 37,611,974 S6T probably benign Het
Ston2 G C 12: 91,714,112 T126S probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tbr1 A G 2: 61,811,630 D150G probably benign Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Ubxn4 C A 1: 128,277,087 Q505K probably damaging Het
Vcl A G 14: 21,003,132 E405G probably damaging Het
Vmn2r26 A T 6: 124,061,691 I742F probably damaging Het
Other mutations in Adh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Adh1 APN 3 138282499 missense probably benign 0.00
IGL00510:Adh1 APN 3 138289907 missense probably damaging 1.00
IGL01326:Adh1 APN 3 138286911 missense probably damaging 1.00
IGL01662:Adh1 APN 3 138282751 missense possibly damaging 0.96
IGL02090:Adh1 APN 3 138282785 missense possibly damaging 0.95
PIT4687001:Adh1 UTSW 3 138289835 missense probably damaging 1.00
R0413:Adh1 UTSW 3 138280432 missense probably benign 0.00
R0882:Adh1 UTSW 3 138286797 missense possibly damaging 0.65
R1426:Adh1 UTSW 3 138286795 missense probably damaging 1.00
R1464:Adh1 UTSW 3 138288747 critical splice acceptor site probably null
R1464:Adh1 UTSW 3 138288747 critical splice acceptor site probably null
R1901:Adh1 UTSW 3 138288797 missense probably benign 0.00
R2056:Adh1 UTSW 3 138286915 missense probably damaging 1.00
R2095:Adh1 UTSW 3 138282796 missense probably damaging 1.00
R3155:Adh1 UTSW 3 138280489 missense probably damaging 0.99
R3752:Adh1 UTSW 3 138288794 missense probably benign
R3795:Adh1 UTSW 3 138279765 missense possibly damaging 0.85
R4351:Adh1 UTSW 3 138280497 missense probably benign 0.21
R4698:Adh1 UTSW 3 138282513 missense probably benign 0.05
R4747:Adh1 UTSW 3 138288881 missense probably damaging 1.00
R5626:Adh1 UTSW 3 138280410 missense probably benign 0.04
R6014:Adh1 UTSW 3 138286798 missense probably benign 0.00
R6060:Adh1 UTSW 3 138286783 missense probably damaging 1.00
R6225:Adh1 UTSW 3 138289804 missense probably benign 0.04
R7129:Adh1 UTSW 3 138280474 missense probably damaging 0.98
R7288:Adh1 UTSW 3 138282732 missense probably benign
R7291:Adh1 UTSW 3 138282808 missense probably damaging 1.00
R7367:Adh1 UTSW 3 138290551 missense probably benign 0.04
R7378:Adh1 UTSW 3 138288887 splice site probably null
R7453:Adh1 UTSW 3 138289941 critical splice donor site probably null
R7613:Adh1 UTSW 3 138286831 nonsense probably null
R8848:Adh1 UTSW 3 138280501 missense probably benign 0.12
Z1187:Adh1 UTSW 3 138286783 missense probably damaging 1.00
Z1190:Adh1 UTSW 3 138286783 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCGCTTTAAATGCGAATG -3'
(R):5'- TTTCCCTTGCAGGAGAACC -3'

Sequencing Primer
(F):5'- GACTAATTAGACTGACATAGCCTGG -3'
(R):5'- ACCTGCTGGTGCCTTCG -3'
Posted On2018-06-22