Incidental Mutation 'PIT4687001:Adh1'
ID556179
Institutional Source Beutler Lab
Gene Symbol Adh1
Ensembl Gene ENSMUSG00000074207
Gene Namealcohol dehydrogenase 1 (class I)
Synonymsclass I alcohol dehydrogenase, ADH-AA, Adh1tl, Adh-1e, Adh-1t, Adh-1-t, Adh-1, Adh1-t, Adh1-e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4687001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location138260991-138290698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 138289835 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 333 (V333G)
Ref Sequence ENSEMBL: ENSMUSP00000004232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004232] [ENSMUST00000159159]
Predicted Effect probably damaging
Transcript: ENSMUST00000004232
AA Change: V333G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004232
Gene: ENSMUSG00000074207
AA Change: V333G

DomainStartEndE-ValueType
Pfam:ADH_N 34 161 1.3e-25 PFAM
Pfam:ADH_zinc_N 203 337 3.6e-27 PFAM
Pfam:ADH_zinc_N_2 236 369 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159159
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes class I alcohol dehydrogenase, gamma subunit, which is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. Class I alcohol dehydrogenase, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation and plays a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired metabolism of (and sensitivity to) ethanol and retinol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gdpd1 T C 11: 87,059,540 D69G probably damaging Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Adh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Adh1 APN 3 138282499 missense probably benign 0.00
IGL00510:Adh1 APN 3 138289907 missense probably damaging 1.00
IGL01326:Adh1 APN 3 138286911 missense probably damaging 1.00
IGL01662:Adh1 APN 3 138282751 missense possibly damaging 0.96
IGL02090:Adh1 APN 3 138282785 missense possibly damaging 0.95
R0413:Adh1 UTSW 3 138280432 missense probably benign 0.00
R0882:Adh1 UTSW 3 138286797 missense possibly damaging 0.65
R1426:Adh1 UTSW 3 138286795 missense probably damaging 1.00
R1464:Adh1 UTSW 3 138288747 critical splice acceptor site probably null
R1464:Adh1 UTSW 3 138288747 critical splice acceptor site probably null
R1901:Adh1 UTSW 3 138288797 missense probably benign 0.00
R2056:Adh1 UTSW 3 138286915 missense probably damaging 1.00
R2095:Adh1 UTSW 3 138282796 missense probably damaging 1.00
R3155:Adh1 UTSW 3 138280489 missense probably damaging 0.99
R3752:Adh1 UTSW 3 138288794 missense probably benign
R3795:Adh1 UTSW 3 138279765 missense possibly damaging 0.85
R4351:Adh1 UTSW 3 138280497 missense probably benign 0.21
R4698:Adh1 UTSW 3 138282513 missense probably benign 0.05
R4747:Adh1 UTSW 3 138288881 missense probably damaging 1.00
R5626:Adh1 UTSW 3 138280410 missense probably benign 0.04
R6014:Adh1 UTSW 3 138286798 missense probably benign 0.00
R6060:Adh1 UTSW 3 138286783 missense probably damaging 1.00
R6225:Adh1 UTSW 3 138289804 missense probably benign 0.04
R6637:Adh1 UTSW 3 138282470 nonsense probably null
R7129:Adh1 UTSW 3 138280474 missense probably damaging 0.98
R7288:Adh1 UTSW 3 138282732 missense probably benign
R7291:Adh1 UTSW 3 138282808 missense probably damaging 1.00
R7367:Adh1 UTSW 3 138290551 missense probably benign 0.04
R7378:Adh1 UTSW 3 138288887 splice site probably null
R7453:Adh1 UTSW 3 138289941 critical splice donor site probably null
R7613:Adh1 UTSW 3 138286831 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGAGCCTCAGTGTCTGTGC -3'
(R):5'- GTGTAACAATGGGCAACACCAG -3'

Sequencing Primer
(F):5'- CTCAGTGTCTGTGCAGCCTG -3'
(R):5'- ATATACCTGTGTGCAGAGCC -3'
Posted On2019-06-07