Incidental Mutation 'R6569:Crb2'
ID526179
Institutional Source Beutler Lab
Gene Symbol Crb2
Ensembl Gene ENSMUSG00000035403
Gene Namecrumbs family member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6569 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location37776249-37799103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37792151 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 173 (Q173L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050372]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050372
AA Change: Q848L

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058007
Gene: ENSMUSG00000035403
AA Change: Q848L

DomainStartEndE-ValueType
EGF 74 110 1.92e-7 SMART
EGF_CA 112 148 1.69e-12 SMART
EGF_CA 150 186 3.99e-14 SMART
EGF_CA 188 225 8.9e-12 SMART
EGF_CA 227 263 3.79e-6 SMART
EGF 268 322 1.32e-5 SMART
EGF_CA 324 360 5.96e-13 SMART
EGF_CA 362 398 2.54e-7 SMART
EGF 403 440 2.45e0 SMART
low complexity region 446 457 N/A INTRINSIC
LamG 461 592 1.18e-6 SMART
EGF 612 645 4.59e-5 SMART
LamG 671 778 4.45e-2 SMART
EGF 813 846 5.2e-4 SMART
LamG 893 1019 1.68e-1 SMART
EGF 1056 1089 9.55e-3 SMART
EGF 1094 1127 9.85e-5 SMART
EGF 1134 1168 1.91e1 SMART
EGF 1173 1206 3.73e-5 SMART
transmembrane domain 1222 1244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137693
Predicted Effect probably damaging
Transcript: ENSMUST00000147600
AA Change: Q173L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are components of the Crumbs cell polarity complex. In mammals, members of this family are thought to play a role in many cellular processes in early embryonic development. A similar protein in Drosophila determines apicobasal polarity in embryonic epithelial cells. Mutations in this gene are associated with focal segmental glomerulosclerosis 9, and with ventriculomegaly with cystic kidney disease. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous inactivation of this gene causes severe gastrulation defects, impaired somitogenesis and organogenesis. and complete embryonic death by E12.5. Several organ primordia, including neuroepithelium, gut, and heart, fail to form properly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 T A 6: 85,641,339 V2789D probably benign Het
Ccdc40 A G 11: 119,242,734 T567A probably damaging Het
Col7a1 T G 9: 108,978,110 probably null Het
Cuzd1 T C 7: 131,311,757 Y377C probably damaging Het
Echdc1 T C 10: 29,322,284 M75T probably damaging Het
Faah G T 4: 116,017,632 A9E probably benign Het
Gpatch1 T C 7: 35,291,738 D627G probably damaging Het
Grid1 G T 14: 35,323,339 V380F possibly damaging Het
Klf4 T C 4: 55,530,394 Y239C probably damaging Het
Mkx C A 18: 6,992,820 E155* probably null Het
Mmp11 G A 10: 75,927,382 probably benign Het
Mms19 T C 19: 41,964,368 K101E possibly damaging Het
Mrpl23 C A 7: 142,535,039 R44S probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1037 A G 2: 86,085,505 S91P possibly damaging Het
Olfr1248 A G 2: 89,618,015 F59S possibly damaging Het
Olfr857 G A 9: 19,713,342 V172I probably benign Het
Pcdhgc5 C T 18: 37,820,195 P174L probably damaging Het
Phf20l1 A T 15: 66,629,824 D619V probably damaging Het
Plcz1 C T 6: 140,007,707 A395T possibly damaging Het
Rbm45 A G 2: 76,379,072 D410G probably damaging Het
Sh3bp1 T C 15: 78,911,696 L675P probably damaging Het
Taf6l G A 19: 8,772,710 T208I probably damaging Het
Tnpo3 A G 6: 29,571,066 I443T possibly damaging Het
Twistnb T A 12: 33,437,883 C266S probably benign Het
Vmn1r42 A G 6: 89,845,443 L48P probably damaging Het
Vmn2r25 A G 6: 123,851,982 V111A probably benign Het
Other mutations in Crb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Crb2 APN 2 37792064 missense probably damaging 1.00
IGL01357:Crb2 APN 2 37795511 unclassified probably benign
IGL01363:Crb2 APN 2 37793833 missense probably benign 0.01
IGL02006:Crb2 APN 2 37786463 missense probably damaging 1.00
IGL02380:Crb2 APN 2 37783435 missense probably damaging 0.96
IGL02455:Crb2 APN 2 37794564 missense possibly damaging 0.74
IGL03107:Crb2 APN 2 37791416 missense probably benign 0.10
R1350:Crb2 UTSW 2 37792069 missense probably damaging 1.00
R1353:Crb2 UTSW 2 37787281 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1509:Crb2 UTSW 2 37786619 missense probably benign 0.01
R1734:Crb2 UTSW 2 37793656 missense probably damaging 1.00
R2006:Crb2 UTSW 2 37783434 missense probably damaging 0.99
R2918:Crb2 UTSW 2 37783383 missense probably benign 0.01
R3431:Crb2 UTSW 2 37792217 missense probably benign 0.24
R3975:Crb2 UTSW 2 37793668 missense possibly damaging 0.74
R4074:Crb2 UTSW 2 37786843 missense probably damaging 1.00
R4518:Crb2 UTSW 2 37790389 missense probably damaging 1.00
R4521:Crb2 UTSW 2 37795337 unclassified probably benign
R4801:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4802:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4913:Crb2 UTSW 2 37790245 missense probably benign
R4930:Crb2 UTSW 2 37783314 missense probably damaging 1.00
R4947:Crb2 UTSW 2 37795331 unclassified probably benign
R4959:Crb2 UTSW 2 37790470 missense probably damaging 0.99
R5215:Crb2 UTSW 2 37793753 missense probably benign 0.23
R5268:Crb2 UTSW 2 37790821 missense probably damaging 1.00
R5446:Crb2 UTSW 2 37795449 missense probably benign 0.16
R5739:Crb2 UTSW 2 37793654 missense probably damaging 0.99
R5875:Crb2 UTSW 2 37787254 splice site probably null
R6179:Crb2 UTSW 2 37790257 missense probably damaging 1.00
R6450:Crb2 UTSW 2 37793826 missense possibly damaging 0.91
R6828:Crb2 UTSW 2 37776409 small deletion probably benign
R7040:Crb2 UTSW 2 37787684 missense probably benign 0.32
R7153:Crb2 UTSW 2 37787408 missense probably benign 0.00
R7362:Crb2 UTSW 2 37790199 missense probably benign 0.00
R7515:Crb2 UTSW 2 37783400 missense probably damaging 1.00
R7519:Crb2 UTSW 2 37793320 missense probably damaging 1.00
R7583:Crb2 UTSW 2 37790595 missense probably benign 0.00
R7819:Crb2 UTSW 2 37791591 missense probably benign 0.00
R8016:Crb2 UTSW 2 37786556 missense possibly damaging 0.50
R8049:Crb2 UTSW 2 37793240 missense probably benign 0.02
R8090:Crb2 UTSW 2 37795491 missense probably damaging 1.00
X0025:Crb2 UTSW 2 37792209 missense probably damaging 1.00
Z1176:Crb2 UTSW 2 37776371 missense probably benign
Z1177:Crb2 UTSW 2 37787365 missense probably damaging 1.00
Z1177:Crb2 UTSW 2 37790824 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GGGTTTCCCTCAACTCTGTG -3'
(R):5'- ATGCTCACCTTCCCTAAGAGTG -3'

Sequencing Primer
(F):5'- CCCTCAACTCTGTGATGTGGTG -3'
(R):5'- CCCTAAGAGTGTTTCTCAGAATGCAG -3'
Posted On2018-06-22