Incidental Mutation 'R5739:Crb2'
ID444663
Institutional Source Beutler Lab
Gene Symbol Crb2
Ensembl Gene ENSMUSG00000035403
Gene Namecrumbs family member 2
Synonyms
MMRRC Submission 043351-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5739 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location37776249-37799103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37793654 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 1056 (V1056G)
Ref Sequence ENSEMBL: ENSMUSP00000058007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050372]
Predicted Effect probably damaging
Transcript: ENSMUST00000050372
AA Change: V1056G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058007
Gene: ENSMUSG00000035403
AA Change: V1056G

DomainStartEndE-ValueType
EGF 74 110 1.92e-7 SMART
EGF_CA 112 148 1.69e-12 SMART
EGF_CA 150 186 3.99e-14 SMART
EGF_CA 188 225 8.9e-12 SMART
EGF_CA 227 263 3.79e-6 SMART
EGF 268 322 1.32e-5 SMART
EGF_CA 324 360 5.96e-13 SMART
EGF_CA 362 398 2.54e-7 SMART
EGF 403 440 2.45e0 SMART
low complexity region 446 457 N/A INTRINSIC
LamG 461 592 1.18e-6 SMART
EGF 612 645 4.59e-5 SMART
LamG 671 778 4.45e-2 SMART
EGF 813 846 5.2e-4 SMART
LamG 893 1019 1.68e-1 SMART
EGF 1056 1089 9.55e-3 SMART
EGF 1094 1127 9.85e-5 SMART
EGF 1134 1168 1.91e1 SMART
EGF 1173 1206 3.73e-5 SMART
transmembrane domain 1222 1244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137693
Predicted Effect probably benign
Transcript: ENSMUST00000147600
Meta Mutation Damage Score 0.1807 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are components of the Crumbs cell polarity complex. In mammals, members of this family are thought to play a role in many cellular processes in early embryonic development. A similar protein in Drosophila determines apicobasal polarity in embryonic epithelial cells. Mutations in this gene are associated with focal segmental glomerulosclerosis 9, and with ventriculomegaly with cystic kidney disease. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous inactivation of this gene causes severe gastrulation defects, impaired somitogenesis and organogenesis. and complete embryonic death by E12.5. Several organ primordia, including neuroepithelium, gut, and heart, fail to form properly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,520,541 V356E possibly damaging Het
4931429L15Rik A T 9: 46,309,419 S50T probably benign Het
A930011G23Rik A G 5: 99,221,430 L529P probably damaging Het
Acer2 A T 4: 86,900,555 N147Y probably damaging Het
Adamtsl1 A G 4: 86,232,664 E353G probably damaging Het
Alg6 T C 4: 99,744,500 F60L probably benign Het
Ano6 A T 15: 95,913,379 D120V probably damaging Het
Armc3 A G 2: 19,253,917 D265G possibly damaging Het
Arntl G A 7: 113,285,031 R92Q probably damaging Het
Aurkc A T 7: 7,002,860 Y249F probably benign Het
Cacna2d2 A G 9: 107,512,329 I274V probably benign Het
Camk2n2 C A 16: 20,621,080 G39C probably damaging Het
Ccdc39 A G 3: 33,826,561 L419P possibly damaging Het
Cdh23 T C 10: 60,305,609 M3117V probably damaging Het
Celsr3 A G 9: 108,827,158 E280G probably benign Het
Cherp TGCTGGTGGTGGGG TG 8: 72,467,815 probably benign Het
Clcn6 A G 4: 148,014,189 V494A probably damaging Het
Col19a1 C T 1: 24,337,915 G450S probably damaging Het
Crtac1 A G 19: 42,302,173 F363S probably damaging Het
Dnaaf2 T C 12: 69,196,941 S449G probably benign Het
Dnah7b A T 1: 46,233,992 I2427F probably damaging Het
Dnah8 T A 17: 30,719,007 D1619E probably benign Het
Dock3 A T 9: 106,973,796 S836T possibly damaging Het
Donson A T 16: 91,681,229 probably null Het
Drc3 G A 11: 60,375,130 R215H possibly damaging Het
Entpd2 T C 2: 25,399,492 S329P possibly damaging Het
Eya2 T C 2: 165,761,937 S332P probably damaging Het
Fam83f T A 15: 80,692,005 Y286N probably damaging Het
Fat4 T C 3: 38,983,134 V3645A probably benign Het
G2e3 T C 12: 51,372,504 F668L possibly damaging Het
Gm14403 T A 2: 177,509,247 C329S probably damaging Het
Hmcn1 G A 1: 150,808,697 T374I probably benign Het
Hmcn1 A T 1: 150,758,474 probably null Het
Hrnr T C 3: 93,323,129 S225P unknown Het
Ifi202b C T 1: 173,971,352 probably null Het
Il10ra A T 9: 45,256,070 D394E possibly damaging Het
Itga2b A T 11: 102,465,909 D275E probably benign Het
Jaml A T 9: 45,088,728 D108V probably damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrrtm1 T C 6: 77,244,889 V443A probably damaging Het
Mkln1 T A 6: 31,496,702 S126R probably benign Het
Myo19 T C 11: 84,897,624 I354T probably damaging Het
Nucb1 A T 7: 45,501,660 L99Q probably damaging Het
Olfr1312 A G 2: 112,042,783 F83S probably damaging Het
Pask A G 1: 93,322,056 S541P probably benign Het
Pdpr A T 8: 111,134,620 I749F possibly damaging Het
Phyhipl T C 10: 70,559,569 D269G possibly damaging Het
Pkdcc A G 17: 83,215,794 D110G probably benign Het
Ppox A G 1: 171,279,996 L115P probably damaging Het
Ppp1r12c A G 7: 4,497,282 L94P probably damaging Het
Ppp6r2 T A 15: 89,259,073 M141K probably benign Het
Prl3d1 A T 13: 27,100,012 H188L probably benign Het
Psmb3 T A 11: 97,713,470 probably benign Het
Pxdn T A 12: 29,982,334 S150T probably benign Het
Ripor3 T C 2: 167,981,283 T903A probably damaging Het
Rnase4 T C 14: 51,104,849 L10S probably benign Het
Rnf224 T C 2: 25,236,000 T114A probably benign Het
Rp1l1 A T 14: 64,032,170 E1735V probably benign Het
Rrp1b T A 17: 32,045,976 Y60N probably damaging Het
Rsbn1l A T 5: 20,905,816 V508E probably damaging Het
Rubcnl T C 14: 75,040,941 probably null Het
Rxfp4 A G 3: 88,651,902 probably benign Het
Sdccag8 A G 1: 176,826,231 T85A probably benign Het
Slc46a1 A T 11: 78,467,149 I343F possibly damaging Het
Ssh2 A G 11: 77,449,813 D597G probably damaging Het
Syne2 T A 12: 75,997,465 V3942E possibly damaging Het
Timd4 T C 11: 46,817,746 S200P probably benign Het
Tmc5 G A 7: 118,666,611 probably null Het
Tmem8 T A 17: 26,120,451 F580I probably damaging Het
Trbv16 A G 6: 41,152,079 T66A probably benign Het
Ttc3 A T 16: 94,439,324 K1103* probably null Het
Ttc7b A G 12: 100,384,233 V458A probably damaging Het
Ubxn10 A G 4: 138,720,823 S181P probably benign Het
Vmn2r11 A G 5: 109,059,248 probably null Het
Vmn2r26 A T 6: 124,025,966 N112Y probably benign Het
Vmn2r5 T C 3: 64,504,076 D357G probably damaging Het
Zc3h10 T C 10: 128,544,801 N229S probably benign Het
Zfp407 T C 18: 84,208,742 *2247W probably null Het
Zfyve1 C A 12: 83,575,136 V162L possibly damaging Het
Other mutations in Crb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Crb2 APN 2 37792064 missense probably damaging 1.00
IGL01357:Crb2 APN 2 37795511 unclassified probably benign
IGL01363:Crb2 APN 2 37793833 missense probably benign 0.01
IGL02006:Crb2 APN 2 37786463 missense probably damaging 1.00
IGL02380:Crb2 APN 2 37783435 missense probably damaging 0.96
IGL02455:Crb2 APN 2 37794564 missense possibly damaging 0.74
IGL03107:Crb2 APN 2 37791416 missense probably benign 0.10
R1350:Crb2 UTSW 2 37792069 missense probably damaging 1.00
R1353:Crb2 UTSW 2 37787281 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1509:Crb2 UTSW 2 37786619 missense probably benign 0.01
R1734:Crb2 UTSW 2 37793656 missense probably damaging 1.00
R2006:Crb2 UTSW 2 37783434 missense probably damaging 0.99
R2918:Crb2 UTSW 2 37783383 missense probably benign 0.01
R3431:Crb2 UTSW 2 37792217 missense probably benign 0.24
R3975:Crb2 UTSW 2 37793668 missense possibly damaging 0.74
R4074:Crb2 UTSW 2 37786843 missense probably damaging 1.00
R4518:Crb2 UTSW 2 37790389 missense probably damaging 1.00
R4521:Crb2 UTSW 2 37795337 unclassified probably benign
R4801:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4802:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4913:Crb2 UTSW 2 37790245 missense probably benign
R4930:Crb2 UTSW 2 37783314 missense probably damaging 1.00
R4947:Crb2 UTSW 2 37795331 unclassified probably benign
R4959:Crb2 UTSW 2 37790470 missense probably damaging 0.99
R5215:Crb2 UTSW 2 37793753 missense probably benign 0.23
R5268:Crb2 UTSW 2 37790821 missense probably damaging 1.00
R5446:Crb2 UTSW 2 37795449 missense probably benign 0.16
R5875:Crb2 UTSW 2 37787254 splice site probably null
R6179:Crb2 UTSW 2 37790257 missense probably damaging 1.00
R6450:Crb2 UTSW 2 37793826 missense possibly damaging 0.91
R6569:Crb2 UTSW 2 37792151 missense probably damaging 0.99
R6828:Crb2 UTSW 2 37776409 small deletion probably benign
R7040:Crb2 UTSW 2 37787684 missense probably benign 0.32
R7153:Crb2 UTSW 2 37787408 missense probably benign 0.00
R7362:Crb2 UTSW 2 37790199 missense probably benign 0.00
R7515:Crb2 UTSW 2 37783400 missense probably damaging 1.00
R7519:Crb2 UTSW 2 37793320 missense probably damaging 1.00
R7583:Crb2 UTSW 2 37790595 missense probably benign 0.00
R7819:Crb2 UTSW 2 37791591 missense probably benign 0.00
R8016:Crb2 UTSW 2 37786556 missense possibly damaging 0.50
R8049:Crb2 UTSW 2 37793240 missense probably benign 0.02
R8090:Crb2 UTSW 2 37795491 missense probably damaging 1.00
X0025:Crb2 UTSW 2 37792209 missense probably damaging 1.00
Z1176:Crb2 UTSW 2 37776371 missense probably benign
Z1177:Crb2 UTSW 2 37787365 missense probably damaging 1.00
Z1177:Crb2 UTSW 2 37790824 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACTCCAATATCTGGTTGGCGG -3'
(R):5'- AGCAGTCATCTCTACCCACTG -3'

Sequencing Primer
(F):5'- ACCTGGGCTTTCTGCAGG -3'
(R):5'- ACTGCTATGCCCAGGTCAG -3'
Posted On2016-11-21