Incidental Mutation 'R8049:Crb2'
ID618914
Institutional Source Beutler Lab
Gene Symbol Crb2
Ensembl Gene ENSMUSG00000035403
Gene Namecrumbs family member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8049 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37776249-37799103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37793240 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 918 (G918D)
Ref Sequence ENSEMBL: ENSMUSP00000058007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050372]
Predicted Effect probably benign
Transcript: ENSMUST00000050372
AA Change: G918D

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000058007
Gene: ENSMUSG00000035403
AA Change: G918D

DomainStartEndE-ValueType
EGF 74 110 1.92e-7 SMART
EGF_CA 112 148 1.69e-12 SMART
EGF_CA 150 186 3.99e-14 SMART
EGF_CA 188 225 8.9e-12 SMART
EGF_CA 227 263 3.79e-6 SMART
EGF 268 322 1.32e-5 SMART
EGF_CA 324 360 5.96e-13 SMART
EGF_CA 362 398 2.54e-7 SMART
EGF 403 440 2.45e0 SMART
low complexity region 446 457 N/A INTRINSIC
LamG 461 592 1.18e-6 SMART
EGF 612 645 4.59e-5 SMART
LamG 671 778 4.45e-2 SMART
EGF 813 846 5.2e-4 SMART
LamG 893 1019 1.68e-1 SMART
EGF 1056 1089 9.55e-3 SMART
EGF 1094 1127 9.85e-5 SMART
EGF 1134 1168 1.91e1 SMART
EGF 1173 1206 3.73e-5 SMART
transmembrane domain 1222 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147600
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are components of the Crumbs cell polarity complex. In mammals, members of this family are thought to play a role in many cellular processes in early embryonic development. A similar protein in Drosophila determines apicobasal polarity in embryonic epithelial cells. Mutations in this gene are associated with focal segmental glomerulosclerosis 9, and with ventriculomegaly with cystic kidney disease. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous inactivation of this gene causes severe gastrulation defects, impaired somitogenesis and organogenesis. and complete embryonic death by E12.5. Several organ primordia, including neuroepithelium, gut, and heart, fail to form properly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,104 T69S probably benign Het
2310050C09Rik A T 3: 92,868,895 Y160* probably null Het
2610044O15Rik8 A T 8: 129,220,074 L90H probably damaging Het
3110001I22Rik C T 16: 13,677,759 R241C probably damaging Het
3632451O06Rik G T 14: 49,773,536 A238E probably damaging Het
5730455P16Rik A G 11: 80,377,972 S4P possibly damaging Het
Abca13 T A 11: 9,291,867 N1243K probably damaging Het
Adgrg6 A T 10: 14,428,199 S824T probably benign Het
C3ar1 T A 6: 122,850,100 Y386F probably damaging Het
Cdc14a T C 3: 116,293,928 N527S probably benign Het
Cfap69 A T 5: 5,619,085 probably benign Het
Col7a1 C T 9: 108,975,563 P2279S unknown Het
Dcn C A 10: 97,513,617 N250K probably damaging Het
Dctn5 G A 7: 122,133,243 probably benign Het
Ddx55 T C 5: 124,556,758 V83A probably damaging Het
Dnaja2 T A 8: 85,539,247 H403L possibly damaging Het
Dpy19l4 T C 4: 11,303,982 I143V probably benign Het
Efna5 G T 17: 62,650,982 T93K probably benign Het
Eml6 A G 11: 29,893,201 V171A possibly damaging Het
Esyt1 C G 10: 128,512,086 V942L probably benign Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam78a C A 2: 32,083,023 probably benign Het
Fat2 A G 11: 55,312,066 Y61H probably benign Het
Fbxw14 A T 9: 109,276,143 M318K probably damaging Het
Gm14295 A G 2: 176,809,078 I120M probably benign Het
Gm14403 T A 2: 177,508,518 Y86N probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr55 T C 1: 85,941,697 D54G probably benign Het
Gtf2b T G 3: 142,778,214 S50A probably damaging Het
Ifit3 A T 19: 34,588,080 E342V possibly damaging Het
Iqgap3 T A 3: 88,104,302 I798N probably damaging Het
Lpin1 T C 12: 16,563,684 D494G Het
Lsm12 T C 11: 102,165,409 E149G possibly damaging Het
Mtfr2 T C 10: 20,352,857 S50P possibly damaging Het
Ndnf T C 6: 65,703,430 M231T probably benign Het
Noc3l A T 19: 38,812,429 V203E probably benign Het
Olfr368 A T 2: 37,332,334 T196S probably damaging Het
Olfr387-ps1 G T 11: 73,665,162 K184N possibly damaging Het
Olfr649 C A 7: 104,189,810 L132F probably damaging Het
Olfr824 A T 10: 130,126,600 Y152* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pde6b C T 5: 108,425,252 P496L probably benign Het
Plppr1 A T 4: 49,300,942 M92L probably benign Het
Ptprk C G 10: 28,383,569 S335C possibly damaging Het
Rars2 T A 4: 34,650,217 M334K probably benign Het
Rasl10a A T 11: 5,059,823 I124F probably damaging Het
Rgs12 T A 5: 35,026,030 V1007E possibly damaging Het
Rnf122 T A 8: 31,128,580 C119S probably damaging Het
Scn11a T A 9: 119,755,083 I1489F probably damaging Het
Setd6 C A 8: 95,716,688 S186R probably benign Het
Tex19.1 A G 11: 121,147,322 T169A probably benign Het
Th G A 7: 142,894,123 P408S probably damaging Het
Trappc13 T C 13: 104,144,544 M337V probably benign Het
Treml2 A T 17: 48,302,734 K65* probably null Het
Ubxn4 T C 1: 128,256,196 S98P probably damaging Het
Wrnip1 A G 13: 32,821,977 S601G probably benign Het
Other mutations in Crb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Crb2 APN 2 37792064 missense probably damaging 1.00
IGL01357:Crb2 APN 2 37795511 unclassified probably benign
IGL01363:Crb2 APN 2 37793833 missense probably benign 0.01
IGL02006:Crb2 APN 2 37786463 missense probably damaging 1.00
IGL02380:Crb2 APN 2 37783435 missense probably damaging 0.96
IGL02455:Crb2 APN 2 37794564 missense possibly damaging 0.74
IGL03107:Crb2 APN 2 37791416 missense probably benign 0.10
R1350:Crb2 UTSW 2 37792069 missense probably damaging 1.00
R1353:Crb2 UTSW 2 37787281 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1509:Crb2 UTSW 2 37786619 missense probably benign 0.01
R1734:Crb2 UTSW 2 37793656 missense probably damaging 1.00
R2006:Crb2 UTSW 2 37783434 missense probably damaging 0.99
R2918:Crb2 UTSW 2 37783383 missense probably benign 0.01
R3431:Crb2 UTSW 2 37792217 missense probably benign 0.24
R3975:Crb2 UTSW 2 37793668 missense possibly damaging 0.74
R4074:Crb2 UTSW 2 37786843 missense probably damaging 1.00
R4518:Crb2 UTSW 2 37790389 missense probably damaging 1.00
R4521:Crb2 UTSW 2 37795337 unclassified probably benign
R4801:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4802:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4913:Crb2 UTSW 2 37790245 missense probably benign
R4930:Crb2 UTSW 2 37783314 missense probably damaging 1.00
R4947:Crb2 UTSW 2 37795331 unclassified probably benign
R4959:Crb2 UTSW 2 37790470 missense probably damaging 0.99
R5215:Crb2 UTSW 2 37793753 missense probably benign 0.23
R5268:Crb2 UTSW 2 37790821 missense probably damaging 1.00
R5446:Crb2 UTSW 2 37795449 missense probably benign 0.16
R5739:Crb2 UTSW 2 37793654 missense probably damaging 0.99
R5875:Crb2 UTSW 2 37787254 splice site probably null
R6179:Crb2 UTSW 2 37790257 missense probably damaging 1.00
R6450:Crb2 UTSW 2 37793826 missense possibly damaging 0.91
R6569:Crb2 UTSW 2 37792151 missense probably damaging 0.99
R6828:Crb2 UTSW 2 37776409 small deletion probably benign
R7040:Crb2 UTSW 2 37787684 missense probably benign 0.32
R7153:Crb2 UTSW 2 37787408 missense probably benign 0.00
R7362:Crb2 UTSW 2 37790199 missense probably benign 0.00
R7515:Crb2 UTSW 2 37783400 missense probably damaging 1.00
R7519:Crb2 UTSW 2 37793320 missense probably damaging 1.00
R7583:Crb2 UTSW 2 37790595 missense probably benign 0.00
R7819:Crb2 UTSW 2 37791591 missense probably benign 0.00
R8016:Crb2 UTSW 2 37786556 missense possibly damaging 0.50
R8090:Crb2 UTSW 2 37795491 missense probably damaging 1.00
X0025:Crb2 UTSW 2 37792209 missense probably damaging 1.00
Z1176:Crb2 UTSW 2 37776371 missense probably benign
Z1177:Crb2 UTSW 2 37787365 missense probably damaging 1.00
Z1177:Crb2 UTSW 2 37790824 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AAGTCTGGCAGGTCATTTCC -3'
(R):5'- TGAAGTTCTCAGCCAGTAGC -3'

Sequencing Primer
(F):5'- AGGTCATTTCCCAGCGGCTC -3'
(R):5'- TGCAGAAAGCCCAGGTCG -3'
Posted On2020-01-23