Incidental Mutation 'R6656:Keg1'
ID 526642
Institutional Source Beutler Lab
Gene Symbol Keg1
Ensembl Gene ENSMUSG00000024694
Gene Name kidney expressed gene 1
Synonyms 0610008P16Rik, GS4059
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock # R6656 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 12695786-12719902 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 12709630 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 8 (Q8*)
Ref Sequence ENSEMBL: ENSMUSP00000119879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025598] [ENSMUST00000138545] [ENSMUST00000154822]
AlphaFold Q9DCY0
Predicted Effect probably null
Transcript: ENSMUST00000025598
AA Change: Q8*
SMART Domains Protein: ENSMUSP00000025598
Gene: ENSMUSG00000024694
AA Change: Q8*

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 205 1.2e-89 PFAM
Pfam:Gly_acyl_tr_C 206 294 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128987
Predicted Effect probably null
Transcript: ENSMUST00000138545
AA Change: Q8*
SMART Domains Protein: ENSMUSP00000116555
Gene: ENSMUSG00000024694
AA Change: Q8*

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 195 4.2e-96 PFAM
Pfam:Gly_acyl_tr_C 196 228 4.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152017
Predicted Effect probably null
Transcript: ENSMUST00000154822
AA Change: Q8*
SMART Domains Protein: ENSMUSP00000119879
Gene: ENSMUSG00000024694
AA Change: Q8*

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 156 1.2e-71 PFAM
Pfam:Gly_acyl_tr_C 153 221 3.2e-37 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.8%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik A G 10: 117,235,629 V115A probably benign Het
Ahctf1 T C 1: 179,753,513 N1708S probably benign Het
Ahnak2 C T 12: 112,785,371 M285I probably benign Het
Angptl1 A T 1: 156,857,236 D325V probably damaging Het
Anln A T 9: 22,351,002 V931E probably damaging Het
Ascc3 C T 10: 50,649,925 R578* probably null Het
B3galnt2 C T 13: 13,975,576 A168V probably benign Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Cd22 T C 7: 30,877,757 I42V probably benign Het
Cyp2b19 C T 7: 26,766,855 T361I probably benign Het
D930048N14Rik C A 11: 51,653,749 probably benign Het
Ehf T C 2: 103,283,583 N23S probably damaging Het
Eif2ak3 T A 6: 70,883,715 I425N probably damaging Het
Fbxo4 C T 15: 3,975,823 V192M probably damaging Het
Gm10436 A T 12: 88,175,993 L285Q possibly damaging Het
Gm21190 T C 5: 15,525,851 Q169R possibly damaging Het
Gm9733 T C 3: 15,320,498 T115A probably damaging Het
Gngt1 A G 6: 3,994,246 D8G possibly damaging Het
Ift140 T C 17: 25,032,173 L31P probably damaging Het
Lama3 T A 18: 12,549,226 M1083K possibly damaging Het
Lrp1b A T 2: 40,637,864 Y68* probably null Het
Mctp1 A T 13: 77,029,936 K947N probably damaging Het
Muc5ac A G 7: 141,803,328 Y1113C probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Npas2 T G 1: 39,361,948 S798A unknown Het
Olfr532 G T 7: 140,419,604 H56Q probably damaging Het
Orc2 A G 1: 58,493,659 probably null Het
Parpbp T C 10: 88,110,313 T415A probably benign Het
Pcdha3 T C 18: 36,947,822 V539A probably benign Het
Piwil4 T C 9: 14,709,934 E601G probably damaging Het
Ptpn3 T A 4: 57,205,905 I696F probably damaging Het
Sec63 C T 10: 42,816,383 Q617* probably null Het
Sgip1 C A 4: 102,905,568 probably benign Het
Tktl2 T C 8: 66,512,729 V313A probably benign Het
Tmem63b C A 17: 45,667,708 R325L probably benign Het
Ttn C T 2: 76,709,356 G34429R probably damaging Het
Other mutations in Keg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Keg1 APN 19 12719000 missense probably damaging 1.00
IGL01084:Keg1 APN 19 12714612 missense probably damaging 1.00
IGL02563:Keg1 APN 19 12719157 missense probably damaging 1.00
IGL03328:Keg1 APN 19 12719097 missense probably damaging 1.00
R0103:Keg1 UTSW 19 12718916 missense possibly damaging 0.79
R0103:Keg1 UTSW 19 12718916 missense possibly damaging 0.79
R0417:Keg1 UTSW 19 12711060 missense probably damaging 1.00
R1300:Keg1 UTSW 19 12719004 missense probably damaging 0.98
R1476:Keg1 UTSW 19 12716023 missense probably benign
R1482:Keg1 UTSW 19 12718821 missense probably damaging 1.00
R1643:Keg1 UTSW 19 12719042 missense probably benign 0.00
R4002:Keg1 UTSW 19 12718943 missense possibly damaging 0.95
R5022:Keg1 UTSW 19 12719157 missense probably damaging 1.00
R5164:Keg1 UTSW 19 12714680 intron probably benign
R5386:Keg1 UTSW 19 12714538 missense probably damaging 1.00
R6289:Keg1 UTSW 19 12714573 missense probably damaging 0.98
R6517:Keg1 UTSW 19 12715910 missense probably benign 0.00
R7117:Keg1 UTSW 19 12709678 missense probably damaging 1.00
R7676:Keg1 UTSW 19 12716045 missense probably benign 0.00
R7807:Keg1 UTSW 19 12714634 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGGCATTTTAAATAACTGCTGAC -3'
(R):5'- TAGACAGTGGAGAGCAGCACTC -3'

Sequencing Primer
(F):5'- ATATCTTGGGAAGCACTGCC -3'
(R):5'- GCACTCTGCTCCTTTAAAATACTAAG -3'
Posted On 2018-07-23