Incidental Mutation 'R6699:Gm16494'
ID528703
Institutional Source Beutler Lab
Gene Symbol Gm16494
Ensembl Gene ENSMUSG00000091775
Gene Namepredicted gene 16494
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R6699 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location47016696-47016956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47016908 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 17 (V17M)
Ref Sequence ENSEMBL: ENSMUSP00000132093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165525]
Predicted Effect probably damaging
Transcript: ENSMUST00000165525
AA Change: V17M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132093
Gene: ENSMUSG00000091775
AA Change: V17M

DomainStartEndE-ValueType
HMG17 2 83 2.01e-32 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,144,368 T894A probably damaging Het
Adam39 A G 8: 40,826,657 K695R probably benign Het
Agfg1 G A 1: 82,858,454 probably null Het
Ankrd44 G A 1: 54,762,445 T241I probably damaging Het
Car15 T C 16: 17,836,574 D166G probably null Het
Cpne2 G A 8: 94,563,959 V391M probably damaging Het
Ddx27 C T 2: 167,020,503 T155I possibly damaging Het
F830045P16Rik T C 2: 129,460,421 D417G probably damaging Het
Fam217b T G 2: 178,420,417 M58R probably benign Het
Ftmt T C 18: 52,331,665 S18P possibly damaging Het
Gm36864 A T 7: 44,238,772 I342F possibly damaging Het
Grid2 C G 6: 63,931,047 R224G possibly damaging Het
Hist1h4k A T 13: 21,750,504 M1K probably null Het
Hmgcr T C 13: 96,660,209 E191G probably damaging Het
Hrc A G 7: 45,335,695 D90G possibly damaging Het
Kbtbd7 A G 14: 79,428,192 E488G probably benign Het
Krtap26-1 T C 16: 88,647,715 N6S unknown Het
Mgat2 A G 12: 69,184,781 D43G probably damaging Het
Mrps30 A T 13: 118,380,598 S362T probably damaging Het
Olfr1124 A T 2: 87,434,816 I110F probably benign Het
Olfr224 T A 11: 58,567,205 I47L possibly damaging Het
Pcdhb11 T A 18: 37,422,937 V440E probably damaging Het
Pcdhb18 T A 18: 37,491,952 H778Q probably benign Het
Plekha7 T C 7: 116,135,175 E1025G probably damaging Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Rph3al A T 11: 75,900,837 probably benign Het
Rrm1 T A 7: 102,460,825 Y556N probably damaging Het
Saal1 A T 7: 46,692,817 C401S probably damaging Het
Sec14l3 T C 11: 4,075,193 S268P possibly damaging Het
Tmem54 A G 4: 129,111,325 I199M probably benign Het
Tomm70a A G 16: 57,142,802 M395V probably benign Het
Topors A G 4: 40,262,300 V328A probably damaging Het
Vmn2r61 T G 7: 42,300,156 S667A probably benign Het
Vmn2r68 G A 7: 85,232,375 A499V possibly damaging Het
Zcchc14 A T 8: 121,608,616 probably benign Het
Other mutations in Gm16494
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1469:Gm16494 UTSW 17 47016844 missense probably damaging 1.00
R1469:Gm16494 UTSW 17 47016844 missense probably damaging 1.00
R2894:Gm16494 UTSW 17 47016706 missense unknown
R4600:Gm16494 UTSW 17 47016797 nonsense probably null
R7751:Gm16494 UTSW 17 47016874 nonsense probably null
R8296:Gm16494 UTSW 17 47016824 missense probably damaging 0.99
RF056:Gm16494 UTSW 17 47016915 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGCATCTTCAGCATCTTCAGC -3'
(R):5'- TGGCTACAATATACTATGCACCAACTC -3'

Sequencing Primer
(F):5'- AGCATCTTCAGCTTTCTGTGC -3'
(R):5'- CTAGTACTTTTGGATGCTGCTATTAC -3'
Posted On2018-07-24