Mutagenetix > Incidental Mutation

Incidental Mutation 'R6718:Pms2'

529459

Institutional Source

Beutler Lab

Gene Symbol

Pms2

Ensembl Gene

ENSMUSG00000079109

Gene Name

PMS1 homolog2, mismatch repair system component

Synonyms

mismatch repair, DNA mismatch repair

MMRRC Submission

044836-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.238) question?

Stock #

R6718 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

143846782-143870786 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 143860307 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 40 (I40T)

Ref Sequence

ENSEMBL: ENSMUSP00000133062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110709] [ENSMUST00000148011] [ENSMUST00000164999]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110707

Predicted Effect

probably benign
Transcript: ENSMUST00000110709

SMART Domains

Protein: ENSMUSP00000106337
Gene: ENSMUSG00000079109

Domain	Start	End	E-Value	Type
HATPase_c	30	165	3.77e-1	SMART
MutL_C	277	421	1.59e-36	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000110710

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126331

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141942

Predicted Effect

possibly damaging
Transcript: ENSMUST00000148011
AA Change: I334T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000119875
Gene: ENSMUSG00000079109
AA Change: I334T

Domain	Start	End	E-Value	Type
HATPase_c	30	165	3.77e-1	SMART
DNA_mis_repair	227	364	4.76e-41	SMART
MutL_C	675	819	1.59e-36	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000164999
AA Change: I40T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000133062
Gene: ENSMUSG00000079109
AA Change: I40T

Domain	Start	End	E-Value	Type
DNA_mis_repair	1	70	4.47e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167009

Predicted Effect

probably benign
Transcript: ENSMUST00000172367

SMART Domains

Protein: ENSMUSP00000132104
Gene: ENSMUSG00000104633

Domain	Start	End	E-Value	Type
MutL_C	5	139	1.78e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170083

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit microsatellite instability and develop a high incidence of lymphomas with some sarcomas after 6 months of age. Mutant males are sterile, with impaired synapsis and only abnormal spermatozoa. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg3l2	G	A	18: 67,554,346 (GRCm39)	T452I	probably damaging	Het
Asb8	A	G	15: 98,034,015 (GRCm39)	I180T	probably benign	Het
Cdh18	A	G	15: 23,226,835 (GRCm39)	T45A	probably benign	Het
Col12a1	T	A	9: 79,606,887 (GRCm39)	Y512F	probably damaging	Het
Col6a1	A	G	10: 76,560,884 (GRCm39)	F38S	probably damaging	Het
Hoxc5	A	G	15: 102,922,698 (GRCm39)		probably null	Het
Kmt2d	TATGCTGCTG	TATGCTGCTGATGCTGCTG	15: 98,747,467 (GRCm39)		probably benign	Het
Kmt2d	C	T	15: 98,748,420 (GRCm39)		probably benign	Het
Lrp2	G	T	2: 69,314,124 (GRCm39)	H2202Q	probably benign	Het
Maf	C	A	8: 116,433,539 (GRCm39)	V22F	unknown	Het
Mrgpra3	C	T	7: 47,239,444 (GRCm39)	V161M	probably benign	Het
Or7g33	G	T	9: 19,448,495 (GRCm39)	H244N	probably damaging	Het
Otx1	T	C	11: 21,946,412 (GRCm39)		probably benign	Het
Parvb	C	T	15: 84,182,180 (GRCm39)	R237W	probably damaging	Het
Pex11a	A	G	7: 79,387,230 (GRCm39)	F201L	probably benign	Het
Pigu	A	G	2: 155,143,206 (GRCm39)	Y232H	possibly damaging	Het
Pura	A	G	18: 36,420,696 (GRCm39)	N161S	probably damaging	Het
Ranbp10	A	G	8: 106,501,260 (GRCm39)	V330A	possibly damaging	Het
Slc30a9	T	C	5: 67,490,443 (GRCm39)	V218A	probably damaging	Het
Spindoc	C	T	19: 7,335,781 (GRCm39)	V336I	probably damaging	Het
Tmprss9	A	G	10: 80,726,198 (GRCm39)	T483A	probably benign	Het

Other mutations in Pms2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01893:Pms2	APN	5	143,860,337 (GRCm39)	missense	probably damaging	1.00
IGL02009:Pms2	APN	5	143,862,582 (GRCm39)	missense	probably benign	0.42
IGL02801:Pms2	APN	5	143,862,653 (GRCm39)	missense	probably benign	0.06
P0047:Pms2	UTSW	5	143,856,416 (GRCm39)	missense	probably damaging	1.00
R1367:Pms2	UTSW	5	143,862,731 (GRCm39)	missense	probably damaging	1.00
R1422:Pms2	UTSW	5	143,850,523 (GRCm39)	missense	probably damaging	1.00
R1854:Pms2	UTSW	5	143,862,714 (GRCm39)	missense	probably benign	0.08
R1997:Pms2	UTSW	5	143,850,518 (GRCm39)	missense	probably damaging	1.00
R2248:Pms2	UTSW	5	143,853,324 (GRCm39)	missense	probably damaging	1.00
R2873:Pms2	UTSW	5	143,848,732 (GRCm39)	splice site	probably benign
R4072:Pms2	UTSW	5	143,865,819 (GRCm39)	missense	probably damaging	0.99
R4082:Pms2	UTSW	5	143,867,837 (GRCm39)	missense	probably damaging	1.00
R4358:Pms2	UTSW	5	143,862,744 (GRCm39)	missense	probably damaging	1.00
R5100:Pms2	UTSW	5	143,865,006 (GRCm39)	missense	probably damaging	1.00
R5101:Pms2	UTSW	5	143,865,006 (GRCm39)	missense	probably damaging	1.00
R5228:Pms2	UTSW	5	143,860,415 (GRCm39)	missense	probably damaging	0.99
R5484:Pms2	UTSW	5	143,864,943 (GRCm39)	missense	probably damaging	1.00
R6310:Pms2	UTSW	5	143,860,401 (GRCm39)	missense	probably benign	0.06
R6331:Pms2	UTSW	5	143,851,451 (GRCm39)	missense	possibly damaging	0.94
R6567:Pms2	UTSW	5	143,865,786 (GRCm39)	missense	probably damaging	0.99
R6747:Pms2	UTSW	5	143,862,237 (GRCm39)	missense	probably benign	0.02
R6980:Pms2	UTSW	5	143,848,842 (GRCm39)	missense	probably benign	0.21
R7207:Pms2	UTSW	5	143,850,452 (GRCm39)	missense	probably damaging	1.00
R7349:Pms2	UTSW	5	143,862,654 (GRCm39)	missense	probably benign	0.11
R7657:Pms2	UTSW	5	143,856,357 (GRCm39)	missense	possibly damaging	0.93
R7820:Pms2	UTSW	5	143,851,451 (GRCm39)	missense	possibly damaging	0.80
R7980:Pms2	UTSW	5	143,867,909 (GRCm39)	missense	probably damaging	1.00
R8213:Pms2	UTSW	5	143,851,589 (GRCm39)	missense	probably damaging	1.00
R8534:Pms2	UTSW	5	143,860,445 (GRCm39)	missense	probably benign	0.16
R9021:Pms2	UTSW	5	143,862,744 (GRCm39)	missense	probably damaging	1.00
R9218:Pms2	UTSW	5	143,867,945 (GRCm39)	missense	probably benign
R9494:Pms2	UTSW	5	143,853,214 (GRCm39)	missense	probably damaging	1.00
R9614:Pms2	UTSW	5	143,854,420 (GRCm39)	missense	probably benign	0.01
R9712:Pms2	UTSW	5	143,851,614 (GRCm39)	missense	probably damaging	0.99
X0064:Pms2	UTSW	5	143,853,284 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AACTCATACATTGCATATATTCCCC -3'
(R):5'- ACTTTTAGAAGGTCCATCACTGC -3'

Sequencing Primer
(F):5'- CAATACTAGACTGGACACCATT -3'
(R):5'- GTCTGAAGACAGCTACAGTGTACTC -3'

Posted On

2018-08-01