Incidental Mutation 'R6760:Mrgpra1'
ID531192
Institutional Source Beutler Lab
Gene Symbol Mrgpra1
Ensembl Gene ENSMUSG00000050650
Gene NameMAS-related GPR, member A1
SynonymsMrgA1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6760 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location47334875-47354240 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47335041 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 297 (R297W)
Ref Sequence ENSEMBL: ENSMUSP00000129978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098438]
Predicted Effect probably benign
Transcript: ENSMUST00000098438
AA Change: R297W

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129978
Gene: ENSMUSG00000050650
AA Change: R297W

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 36 49 N/A INTRINSIC
Pfam:7tm_1 57 225 2.1e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 C A 4: 40,180,210 C370* probably null Het
Akap2 T C 4: 57,856,026 W493R probably damaging Het
Akap6 C T 12: 53,139,778 S1325L probably damaging Het
Atp2a3 A G 11: 72,982,740 D813G probably damaging Het
Baz2b T A 2: 59,962,432 I451F probably benign Het
Calm2 T C 17: 87,435,695 D65G probably benign Het
Cdh23 C T 10: 60,306,168 V3049M probably damaging Het
Cfap46 A G 7: 139,652,440 L869P probably damaging Het
Chrna9 T A 5: 65,971,228 Y260N probably damaging Het
Clock G A 5: 76,226,976 P782L unknown Het
Coro2a A G 4: 46,540,572 M449T probably benign Het
Crispld1 T G 1: 17,750,801 V355G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Gpr37 T C 6: 25,669,169 I559V probably benign Het
Grik5 A G 7: 25,058,939 probably null Het
Itga8 T C 2: 12,301,640 Y48C probably damaging Het
Manba T C 3: 135,542,451 V367A probably damaging Het
Myh7b C A 2: 155,620,118 Y311* probably null Het
Nmd3 T A 3: 69,746,837 probably null Het
Olfr1034 T A 2: 86,047,014 C177* probably null Het
Pcdhb11 A T 18: 37,421,584 probably benign Het
Plcb1 C T 2: 135,472,060 T1144M possibly damaging Het
Sfrp1 A G 8: 23,411,888 D35G probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Timeless A G 10: 128,246,117 K537R probably benign Het
Tnrc6a T A 7: 123,171,999 V1004E probably damaging Het
Tubb4a T C 17: 57,080,796 E410G possibly damaging Het
U2surp G A 9: 95,493,711 A143V probably benign Het
Vmn2r118 T A 17: 55,592,714 H730L possibly damaging Het
Vmn2r28 G A 7: 5,481,230 T657I probably damaging Het
Ybey A T 10: 76,468,199 N56K probably benign Het
Other mutations in Mrgpra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Mrgpra1 APN 7 47335578 missense probably benign 0.00
IGL01317:Mrgpra1 APN 7 47335624 missense probably benign 0.00
IGL01718:Mrgpra1 APN 7 47335927 splice site probably null
IGL02252:Mrgpra1 APN 7 47335164 missense probably benign 0.00
IGL03301:Mrgpra1 APN 7 47335416 missense probably benign
R0012:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R1019:Mrgpra1 UTSW 7 47335085 missense probably benign 0.00
R2224:Mrgpra1 UTSW 7 47335106 missense possibly damaging 0.50
R2520:Mrgpra1 UTSW 7 47335272 missense possibly damaging 0.75
R2924:Mrgpra1 UTSW 7 47334870 unclassified probably null
R3038:Mrgpra1 UTSW 7 47334996 nonsense probably null
R3900:Mrgpra1 UTSW 7 47335527 missense possibly damaging 0.76
R4692:Mrgpra1 UTSW 7 47335698 missense probably damaging 1.00
R4783:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R4784:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R4785:Mrgpra1 UTSW 7 47335470 missense probably damaging 0.98
R4981:Mrgpra1 UTSW 7 47335211 missense probably damaging 1.00
R5031:Mrgpra1 UTSW 7 47335237 nonsense probably null
R7305:Mrgpra1 UTSW 7 47335455 missense probably benign 0.38
R7348:Mrgpra1 UTSW 7 47335409 missense probably benign 0.09
R7837:Mrgpra1 UTSW 7 47335328 missense possibly damaging 0.68
R8158:Mrgpra1 UTSW 7 47335456 nonsense probably null
X0012:Mrgpra1 UTSW 7 47335875 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATTGGTCAAGTGCAGCAGG -3'
(R):5'- TGGGCAGATAAAGCTTACCAG -3'

Sequencing Primer
(F):5'- GTGCAGCAGGGCAATGC -3'
(R):5'- GCAGATAAAGCTTACCAGATTGTATG -3'
Posted On2018-08-01