Incidental Mutation 'R6760:Vmn2r118'
ID 531205
Institutional Source Beutler Lab
Gene Symbol Vmn2r118
Ensembl Gene ENSMUSG00000091504
Gene Name vomeronasal 2, receptor 118
Synonyms EG383258, Vmn2r119, EG668547
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R6760 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 55592341-55624672 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55592714 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 730 (H730L)
Ref Sequence ENSEMBL: ENSMUSP00000131128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168440]
AlphaFold E9Q1C1
Predicted Effect possibly damaging
Transcript: ENSMUST00000168440
AA Change: H730L

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131128
Gene: ENSMUSG00000091504
AA Change: H730L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 142 470 4.6e-27 PFAM
Pfam:NCD3G 513 566 2.6e-20 PFAM
Pfam:7tm_3 599 834 5.9e-55 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 C A 4: 40,180,210 C370* probably null Het
Akap2 T C 4: 57,856,026 W493R probably damaging Het
Akap6 C T 12: 53,139,778 S1325L probably damaging Het
Atp2a3 A G 11: 72,982,740 D813G probably damaging Het
Baz2b T A 2: 59,962,432 I451F probably benign Het
Calm2 T C 17: 87,435,695 D65G probably benign Het
Cdh23 C T 10: 60,306,168 V3049M probably damaging Het
Cfap46 A G 7: 139,652,440 L869P probably damaging Het
Chrna9 T A 5: 65,971,228 Y260N probably damaging Het
Clock G A 5: 76,226,976 P782L unknown Het
Coro2a A G 4: 46,540,572 M449T probably benign Het
Crispld1 T G 1: 17,750,801 V355G possibly damaging Het
Dnah7c C A 1: 46,649,340 T1890K probably benign Het
Dnah7c A G 1: 46,649,351 S1894G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Gpr37 T C 6: 25,669,169 I559V probably benign Het
Grik5 A G 7: 25,058,939 probably null Het
Itga8 T C 2: 12,301,640 Y48C probably damaging Het
Manba T C 3: 135,542,451 V367A probably damaging Het
Mrgpra1 G A 7: 47,335,041 R297W probably benign Het
Myh7b C A 2: 155,620,118 Y311* probably null Het
Nmd3 T A 3: 69,746,837 probably null Het
Olfr1034 T A 2: 86,047,014 C177* probably null Het
Pcdhb11 A T 18: 37,421,584 probably benign Het
Plcb1 C T 2: 135,472,060 T1144M possibly damaging Het
Sfrp1 A G 8: 23,411,888 D35G probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Timeless A G 10: 128,246,117 K537R probably benign Het
Tnrc6a T A 7: 123,171,999 V1004E probably damaging Het
Tubb4a T C 17: 57,080,796 E410G possibly damaging Het
U2surp G A 9: 95,493,711 A143V probably benign Het
Vmn2r28 G A 7: 5,481,230 T657I probably damaging Het
Ybey A T 10: 76,468,199 N56K probably benign Het
Other mutations in Vmn2r118
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Vmn2r118 APN 17 55592708 missense probably damaging 1.00
IGL00976:Vmn2r118 APN 17 55593204 missense probably damaging 1.00
IGL01419:Vmn2r118 APN 17 55593000 missense probably benign 0.01
IGL01796:Vmn2r118 APN 17 55608585 missense probably benign 0.30
IGL01799:Vmn2r118 APN 17 55592990 missense probably damaging 1.00
IGL02002:Vmn2r118 APN 17 55592619 missense probably damaging 1.00
IGL02075:Vmn2r118 APN 17 55610517 missense probably benign 0.18
IGL02172:Vmn2r118 APN 17 55624598 missense probably benign 0.00
IGL02529:Vmn2r118 APN 17 55610870 missense possibly damaging 0.58
IGL02712:Vmn2r118 APN 17 55592655 missense probably benign 0.21
IGL03096:Vmn2r118 APN 17 55607996 missense probably damaging 1.00
R0306:Vmn2r118 UTSW 17 55608616 missense possibly damaging 0.89
R0329:Vmn2r118 UTSW 17 55610717 missense probably damaging 1.00
R0330:Vmn2r118 UTSW 17 55610717 missense probably damaging 1.00
R0396:Vmn2r118 UTSW 17 55608643 missense probably benign 0.00
R0411:Vmn2r118 UTSW 17 55611021 splice site probably benign
R0513:Vmn2r118 UTSW 17 55610970 nonsense probably null
R0627:Vmn2r118 UTSW 17 55610772 missense probably benign 0.01
R0638:Vmn2r118 UTSW 17 55608466 missense probably benign 0.03
R1328:Vmn2r118 UTSW 17 55608620 missense probably benign 0.01
R1366:Vmn2r118 UTSW 17 55593237 nonsense probably null
R1465:Vmn2r118 UTSW 17 55610935 missense probably benign 0.33
R1465:Vmn2r118 UTSW 17 55610935 missense probably benign 0.33
R1511:Vmn2r118 UTSW 17 55608496 nonsense probably null
R1515:Vmn2r118 UTSW 17 55610643 missense probably benign 0.25
R1550:Vmn2r118 UTSW 17 55608083 missense probably damaging 1.00
R1779:Vmn2r118 UTSW 17 55611530 missense probably benign 0.03
R1834:Vmn2r118 UTSW 17 55592456 missense probably damaging 1.00
R1840:Vmn2r118 UTSW 17 55610406 nonsense probably null
R1854:Vmn2r118 UTSW 17 55611556 missense possibly damaging 0.57
R1967:Vmn2r118 UTSW 17 55592882 missense probably damaging 1.00
R1976:Vmn2r118 UTSW 17 55592925 missense probably damaging 1.00
R2308:Vmn2r118 UTSW 17 55624650 missense probably benign 0.33
R3700:Vmn2r118 UTSW 17 55608421 missense possibly damaging 0.68
R4334:Vmn2r118 UTSW 17 55610347 missense possibly damaging 0.58
R4647:Vmn2r118 UTSW 17 55610665 missense probably damaging 1.00
R4709:Vmn2r118 UTSW 17 55610860 missense probably damaging 1.00
R4805:Vmn2r118 UTSW 17 55592581 missense probably damaging 1.00
R4858:Vmn2r118 UTSW 17 55592894 missense probably damaging 0.98
R5384:Vmn2r118 UTSW 17 55611565 missense probably benign 0.00
R5385:Vmn2r118 UTSW 17 55611565 missense probably benign 0.00
R5664:Vmn2r118 UTSW 17 55592765 missense possibly damaging 0.46
R5740:Vmn2r118 UTSW 17 55593103 missense probably benign 0.00
R5927:Vmn2r118 UTSW 17 55624494 missense probably benign 0.04
R6143:Vmn2r118 UTSW 17 55592871 missense possibly damaging 0.92
R6513:Vmn2r118 UTSW 17 55608093 missense probably damaging 1.00
R6573:Vmn2r118 UTSW 17 55592996 missense probably damaging 1.00
R6794:Vmn2r118 UTSW 17 55592348 missense possibly damaging 0.48
R6929:Vmn2r118 UTSW 17 55610440 missense probably benign 0.01
R7201:Vmn2r118 UTSW 17 55608496 nonsense probably null
R7539:Vmn2r118 UTSW 17 55592853 missense probably damaging 0.98
R7836:Vmn2r118 UTSW 17 55593242 missense probably damaging 0.99
R8179:Vmn2r118 UTSW 17 55608484 missense probably benign 0.36
R8248:Vmn2r118 UTSW 17 55610936 missense probably benign 0.18
R8347:Vmn2r118 UTSW 17 55610423 missense possibly damaging 0.94
R8415:Vmn2r118 UTSW 17 55608057 missense probably benign 0.08
R8428:Vmn2r118 UTSW 17 55608642 missense probably benign 0.33
R8917:Vmn2r118 UTSW 17 55610216 missense possibly damaging 0.82
R8993:Vmn2r118 UTSW 17 55610835 missense possibly damaging 0.72
R9038:Vmn2r118 UTSW 17 55611649 missense probably damaging 1.00
R9155:Vmn2r118 UTSW 17 55610207 missense probably null 0.83
R9603:Vmn2r118 UTSW 17 55592837 missense probably damaging 1.00
R9742:Vmn2r118 UTSW 17 55611009 missense probably damaging 0.98
R9749:Vmn2r118 UTSW 17 55608415 critical splice donor site probably null
R9792:Vmn2r118 UTSW 17 55592496 missense probably damaging 0.99
R9793:Vmn2r118 UTSW 17 55592496 missense probably damaging 0.99
R9795:Vmn2r118 UTSW 17 55592496 missense probably damaging 0.99
X0022:Vmn2r118 UTSW 17 55593218 missense probably damaging 1.00
Z1176:Vmn2r118 UTSW 17 55610655 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAGGTGACCCAAACACTGC -3'
(R):5'- ATTCTGTTCACTGTGGCCG -3'

Sequencing Primer
(F):5'- CAAAACACAAGCATGCTGAATGTTAG -3'
(R):5'- TCTGCGGTCTTGGCTAAAAC -3'
Posted On 2018-08-01