Incidental Mutation 'R6766:Wwc2'
ID531930
Institutional Source Beutler Lab
Gene Symbol Wwc2
Ensembl Gene ENSMUSG00000031563
Gene NameWW, C2 and coiled-coil domain containing 2
SynonymsD8Ertd594e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6766 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location47823959-47990924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47900791 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 103 (Y103H)
Ref Sequence ENSEMBL: ENSMUSP00000056121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057561]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057561
AA Change: Y103H

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000056121
Gene: ENSMUSG00000031563
AA Change: Y103H

DomainStartEndE-ValueType
WW 11 43 3.92e-11 SMART
WW 58 90 4.65e-4 SMART
low complexity region 143 156 N/A INTRINSIC
coiled coil region 162 194 N/A INTRINSIC
coiled coil region 223 254 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
coiled coil region 359 423 N/A INTRINSIC
low complexity region 540 567 N/A INTRINSIC
C2 713 818 5.29e0 SMART
coiled coil region 857 884 N/A INTRINSIC
coiled coil region 1067 1144 N/A INTRINSIC
Meta Mutation Damage Score 0.4070 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WW-and-C2-domain-containing family of proteins. Members of this family have two N-terminal WW domains that mediate binding to target proteins harboring L/PPxY motifs, an internal C2 domain for membrane association, and C-terminal alpha protein kinase C binding sites and class III PDZ domain-interaction motifs. Proteins of this family are able to form homo- and heterodimers and to modulate hippo pathway signaling. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 G A 8: 24,872,630 S17L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd34c A G 9: 89,729,328 V320A probably benign Het
Aox2 C A 1: 58,349,068 L1112I possibly damaging Het
Arap2 A C 5: 62,677,100 probably null Het
Atm A T 9: 53,490,282 I1429N probably damaging Het
Ccdc68 A G 18: 69,966,790 N290D probably damaging Het
Chst1 T C 2: 92,613,197 W5R probably damaging Het
Clip1 G T 5: 123,614,764 probably benign Het
Crebbp T C 16: 4,117,500 T842A probably damaging Het
Cyp2b13 T C 7: 26,081,811 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock1 T A 7: 134,756,793 probably null Het
Dst A G 1: 34,294,483 I4800V probably damaging Het
Efcab7 CAAGTAAAGTAA CAAGTAA 4: 99,877,959 probably null Het
Epb41l2 C T 10: 25,473,092 Q382* probably null Het
Fam83e A G 7: 45,726,646 D261G probably damaging Het
Ifnk T G 4: 35,152,134 S21A possibly damaging Het
Ift122 A G 6: 115,926,243 H1157R probably benign Het
Ighv1-67 T C 12: 115,604,034 K67R possibly damaging Het
Inpp4a C A 1: 37,372,341 A97D probably damaging Het
Insm1 T A 2: 146,223,426 Y387* probably null Het
Irgm1 T C 11: 48,866,101 I294M possibly damaging Het
Isoc2b C T 7: 4,851,062 V104M probably damaging Het
Kif2c A C 4: 117,167,083 S311R probably benign Het
Morn3 G A 5: 123,041,207 A60V probably damaging Het
Oit3 T C 10: 59,438,712 N89D probably damaging Het
Olfr1174-ps T A 2: 88,311,751 Q15L noncoding transcript Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1262 T C 2: 90,002,532 V42A probably benign Het
Olfr293 A T 7: 86,664,085 N141I probably damaging Het
Olfr912 A C 9: 38,581,773 R165S probably damaging Het
Pan2 C A 10: 128,314,512 N708K possibly damaging Het
Parp1 T A 1: 180,598,362 V886E probably damaging Het
Pcdha8 C A 18: 36,994,700 A745E probably benign Het
Pcyox1 C T 6: 86,394,408 probably null Het
Prl2c2 A T 13: 13,002,128 probably null Het
Samd1 T C 8: 83,999,732 S473P possibly damaging Het
Slc26a1 A T 5: 108,671,907 D475E probably damaging Het
Slco1c1 T C 6: 141,547,809 V239A possibly damaging Het
Smo T A 6: 29,736,045 L12Q unknown Homo
Srpk1 C T 17: 28,602,753 R229Q possibly damaging Het
Syn2 T A 6: 115,239,401 F191L probably damaging Het
Syngr2 T C 11: 117,813,435 V182A probably benign Het
Tarbp1 G A 8: 126,447,400 A889V probably benign Het
Tbc1d2b T C 9: 90,226,209 T430A probably benign Het
Tmem217 T A 17: 29,526,510 Y82F probably damaging Het
Ttll9 T A 2: 152,999,300 Y272* probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vsig8 T A 1: 172,560,576 M37K probably benign Het
Vwf G T 6: 125,639,376 D1218Y unknown Het
Wdr11 T G 7: 129,624,312 M727R probably benign Het
Yod1 T A 1: 130,719,271 L295* probably null Het
Zfp113 G T 5: 138,145,346 S214* probably null Het
Zfp438 T A 18: 5,213,780 M393L probably benign Het
Zfp946 G A 17: 22,455,771 C502Y probably benign Het
Other mutations in Wwc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Wwc2 APN 8 47846158 missense unknown
IGL01397:Wwc2 APN 8 47868276 missense unknown
IGL01522:Wwc2 APN 8 47868633 missense unknown
IGL01530:Wwc2 APN 8 47863939 missense unknown
IGL01867:Wwc2 APN 8 47883580 missense probably benign 0.02
IGL01991:Wwc2 APN 8 47869866 nonsense probably null
IGL02092:Wwc2 APN 8 47864535 missense unknown
IGL02320:Wwc2 APN 8 47863847 splice site probably null
IGL02503:Wwc2 APN 8 47849383 missense unknown
H8562:Wwc2 UTSW 8 47920666 missense possibly damaging 0.77
R0244:Wwc2 UTSW 8 47900721 missense probably benign 0.16
R0331:Wwc2 UTSW 8 47880204 missense probably benign 0.15
R0349:Wwc2 UTSW 8 47868666 missense unknown
R0542:Wwc2 UTSW 8 47868379 missense unknown
R0645:Wwc2 UTSW 8 47900639 splice site probably benign
R1081:Wwc2 UTSW 8 47828764 unclassified probably benign
R1167:Wwc2 UTSW 8 47858779 nonsense probably null
R1646:Wwc2 UTSW 8 47842902 missense unknown
R1860:Wwc2 UTSW 8 47990102 missense possibly damaging 0.90
R2070:Wwc2 UTSW 8 47868321 missense unknown
R2183:Wwc2 UTSW 8 47842926 missense unknown
R3969:Wwc2 UTSW 8 47856323 missense unknown
R4096:Wwc2 UTSW 8 47842902 missense unknown
R4387:Wwc2 UTSW 8 47831646 missense unknown
R4447:Wwc2 UTSW 8 47868667 missense unknown
R4448:Wwc2 UTSW 8 47868667 missense unknown
R4450:Wwc2 UTSW 8 47868667 missense unknown
R4646:Wwc2 UTSW 8 47920601 missense probably damaging 1.00
R4869:Wwc2 UTSW 8 47920678 missense probably damaging 0.99
R5159:Wwc2 UTSW 8 47900761 missense probably benign 0.03
R5317:Wwc2 UTSW 8 47847555 missense unknown
R5391:Wwc2 UTSW 8 47863871 missense unknown
R5728:Wwc2 UTSW 8 47864061 missense unknown
R5871:Wwc2 UTSW 8 47868423 missense unknown
R5943:Wwc2 UTSW 8 47990102 missense possibly damaging 0.90
R6137:Wwc2 UTSW 8 47856263 missense unknown
R6169:Wwc2 UTSW 8 47858843 missense unknown
R6363:Wwc2 UTSW 8 47887162 splice site probably null
R6421:Wwc2 UTSW 8 47900746 missense probably damaging 1.00
R6467:Wwc2 UTSW 8 47851908 missense unknown
R6712:Wwc2 UTSW 8 47900803 missense probably benign 0.42
R6765:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6767:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6768:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6782:Wwc2 UTSW 8 47900791 missense possibly damaging 0.85
R6993:Wwc2 UTSW 8 47847465 missense unknown
R7016:Wwc2 UTSW 8 47847548 missense unknown
R7079:Wwc2 UTSW 8 47847545 missense unknown
R7219:Wwc2 UTSW 8 47858884 missense unknown
R7258:Wwc2 UTSW 8 47842999 missense unknown
R7334:Wwc2 UTSW 8 47869794 missense unknown
R7375:Wwc2 UTSW 8 47863920 missense unknown
R7451:Wwc2 UTSW 8 47864575 missense not run
R7505:Wwc2 UTSW 8 47880150 missense probably damaging 0.96
R7825:Wwc2 UTSW 8 47990162 missense probably damaging 1.00
R7854:Wwc2 UTSW 8 47868477 missense unknown
R7904:Wwc2 UTSW 8 47856235 missense unknown
Z1176:Wwc2 UTSW 8 47868549 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGCTCAAAATCTAACCACAGGAG -3'
(R):5'- TCTTAGGCGTTTCCAGCAGG -3'

Sequencing Primer
(F):5'- ACAGGAGTGTGAGTGACTGTCAC -3'
(R):5'- GTGCTTTAGAGGACACAAGGATCC -3'
Posted On2018-08-29