Incidental Mutation 'R6768:Panx3'
ID532048
Institutional Source Beutler Lab
Gene Symbol Panx3
Ensembl Gene ENSMUSG00000011118
Gene Namepannexin 3
Synonyms4833413G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6768 (G1)
Quality Score203.009
Status Validated
Chromosome9
Chromosomal Location37659902-37669235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37664026 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 180 (K180R)
Ref Sequence ENSEMBL: ENSMUSP00000011262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011262] [ENSMUST00000142228]
Predicted Effect probably benign
Transcript: ENSMUST00000011262
AA Change: K180R

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000011262
Gene: ENSMUSG00000011118
AA Change: K180R

DomainStartEndE-ValueType
Pfam:Innexin 33 270 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215047
Meta Mutation Damage Score 0.0825 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are known to be the structural components of gap junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection against surgically induced osteoarthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,421,958 H19Q probably damaging Het
Adam6b G A 12: 113,490,243 V227I probably benign Het
Agtrap A G 4: 148,081,610 V106A probably benign Het
Aldh3a2 A C 11: 61,253,710 S341A probably benign Het
Bmper T A 9: 23,381,453 C353S probably damaging Het
Casq1 C T 1: 172,219,678 D5N probably benign Het
Ccin G A 4: 43,984,574 R327H probably benign Het
Chuk A G 19: 44,096,951 V252A probably damaging Het
Colec11 T C 12: 28,595,101 probably null Het
Cpeb3 G A 19: 37,025,032 T643I possibly damaging Het
Ctcfl A G 2: 173,117,291 V214A possibly damaging Het
Dst A G 1: 34,181,712 E2199G probably damaging Het
Eno2 T C 6: 124,767,748 E45G probably damaging Het
Foxa2 T C 2: 148,043,827 H181R probably damaging Het
Fpgs A G 2: 32,686,623 S331P probably benign Het
Gm47189 A G 14: 41,770,078 S81P probably benign Het
Igsf8 C A 1: 172,317,532 P142Q probably damaging Het
Islr G T 9: 58,157,610 Q205K possibly damaging Het
Josd1 A G 15: 79,677,122 W162R probably benign Het
Lrrc37a G A 11: 103,500,123 T1492I probably benign Het
Meox1 A G 11: 101,879,335 F189L probably damaging Het
Mtf1 G A 4: 124,837,785 D385N probably benign Het
Naip2 A T 13: 100,178,324 C315* probably null Het
Ncaph2 T A 15: 89,363,999 Y166* probably null Het
Nr1i3 G A 1: 171,217,397 V270M probably damaging Het
Olfr155 T C 4: 43,854,351 I14T probably benign Het
Olfr747 A G 14: 50,681,592 L14S probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Reln A C 5: 21,978,907 V1698G probably damaging Het
Rnf213 G T 11: 119,442,236 R2757L probably damaging Het
Scgb2b26 G T 7: 33,944,954 T4K probably damaging Het
Sdhb A G 4: 140,979,053 E267G probably damaging Het
Sorbs1 A T 19: 40,327,547 N383K probably damaging Het
Stk11ip T A 1: 75,532,635 C766S probably benign Het
Taf6l A C 19: 8,774,549 S592A probably damaging Het
Tmem145 G A 7: 25,308,636 G235D probably damaging Het
Tuba3b T A 6: 145,618,729 probably null Het
Ubl7 A T 9: 57,912,762 E32D probably benign Het
Vmn1r168 A T 7: 23,541,035 T106S probably damaging Het
Vmn2r59 C A 7: 42,011,968 V808F probably benign Het
Vmn2r61 C T 7: 42,300,324 P723S probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp11 G T 5: 129,658,351 D15E probably benign Het
Zfp428 G A 7: 24,515,483 G162R probably damaging Het
Zfp629 G A 7: 127,610,825 T604I probably benign Het
Zfpm1 C A 8: 122,334,456 D253E probably damaging Het
Zhx1 G T 15: 58,054,103 T249K probably benign Het
Other mutations in Panx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Panx3 APN 9 37661471 missense probably damaging 1.00
IGL01371:Panx3 APN 9 37661475 missense probably benign 0.03
IGL01458:Panx3 APN 9 37661147 missense probably damaging 0.99
IGL01637:Panx3 APN 9 37664056 missense probably damaging 0.98
R1693:Panx3 UTSW 9 37668907 missense possibly damaging 0.64
R1693:Panx3 UTSW 9 37668946 missense possibly damaging 0.88
R1708:Panx3 UTSW 9 37661391 missense probably benign 0.00
R1818:Panx3 UTSW 9 37664026 missense probably benign 0.04
R2142:Panx3 UTSW 9 37666673 missense probably damaging 1.00
R5386:Panx3 UTSW 9 37669024 missense probably damaging 0.99
R5981:Panx3 UTSW 9 37668881 missense possibly damaging 0.93
R6273:Panx3 UTSW 9 37667429 missense probably benign 0.01
R6429:Panx3 UTSW 9 37661165 missense probably damaging 1.00
R7082:Panx3 UTSW 9 37666617 missense probably benign 0.25
R7165:Panx3 UTSW 9 37664085 missense probably damaging 1.00
R7173:Panx3 UTSW 9 37661300 missense probably damaging 0.99
R7494:Panx3 UTSW 9 37661312 missense probably damaging 1.00
R7629:Panx3 UTSW 9 37661444 missense possibly damaging 0.83
R7650:Panx3 UTSW 9 37661405 missense probably damaging 0.97
R8032:Panx3 UTSW 9 37661670 missense probably damaging 1.00
R8383:Panx3 UTSW 9 37666753 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCGAGTAATCCCTGTGGTTCAG -3'
(R):5'- CATGTATCTGCCAGTGTTGCTG -3'

Sequencing Primer
(F):5'- TGGTTCAGGATCTGTCAACTAGAGAC -3'
(R):5'- GTGGCAATATGTAGCTGTGCCC -3'
Posted On2018-08-29