Incidental Mutation 'R6834:Sox9'
ID534522
Institutional Source Beutler Lab
Gene Symbol Sox9
Ensembl Gene ENSMUSG00000000567
Gene NameSRY (sex determining region Y)-box 9
Synonyms2010306G03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6834 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location112782224-112787760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112784000 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 208 (Q208L)
Ref Sequence ENSEMBL: ENSMUSP00000000579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000579]
Predicted Effect probably benign
Transcript: ENSMUST00000000579
AA Change: Q208L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000000579
Gene: ENSMUSG00000000567
AA Change: Q208L

DomainStartEndE-ValueType
Pfam:Sox_N 22 94 9.6e-29 PFAM
HMG 104 174 2.34e-27 SMART
low complexity region 186 196 N/A INTRINSIC
low complexity region 234 241 N/A INTRINSIC
low complexity region 339 377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene recognizes the sequence CCTTGAG along with other members of the HMG-box class DNA-binding proteins. It acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Muellerian hormone (AMH) gene. Deficiencies lead to the skeletal malformation syndrome campomelic dysplasia, frequently with sex reversal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mutant heterozygotes and conditional knockout mutants display perinatal lethality with cleft palate, hypoplasia and distortion of numerous cartilage-derived skeletal structures, and premature mineralization in many bones. Specific conditional knockout mutations are sex-reversed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,110 W530R possibly damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam15 C T 3: 89,340,083 G426R probably damaging Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Ankrd35 A G 3: 96,683,283 E295G possibly damaging Het
Ap5m1 T A 14: 49,073,737 V88E probably damaging Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
AU018091 T A 7: 3,157,955 I589F probably benign Het
BC052040 T C 2: 115,674,784 S179P probably benign Het
Cenpf T C 1: 189,659,446 K730E probably damaging Het
Chrna6 C T 8: 27,408,310 probably null Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Ell A G 8: 70,579,134 D116G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Epb41l2 T A 10: 25,493,604 V23D possibly damaging Het
Gatad2b T A 3: 90,348,643 S139T probably benign Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm7534 A C 4: 134,193,165 V563G possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gng11 A G 6: 4,008,068 I44V probably benign Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Igkv4-79 A G 6: 69,043,272 S20P probably damaging Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kcnip3 A T 2: 127,458,358 F252I probably damaging Het
Klk11 T C 7: 43,778,912 I242T probably damaging Het
Klk12 T C 7: 43,773,348 V233A possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lmod2 A T 6: 24,597,783 probably benign Het
Loxhd1 T A 18: 77,441,526 V1089E probably damaging Het
Lrba C T 3: 86,350,286 P1286S probably benign Het
Lrrc41 T C 4: 116,096,529 V804A possibly damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Med24 A T 11: 98,705,024 probably null Het
Mrgprx1 T C 7: 48,021,637 S121G probably damaging Het
Mvb12a G A 8: 71,545,252 M103I probably benign Het
Olfr726 A G 14: 50,084,228 V151A probably damaging Het
Olfr730 T C 14: 50,186,483 I245V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacsin3 T A 2: 91,262,835 M224K probably damaging Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Ptar1 A G 19: 23,717,924 T252A probably benign Het
Ptprz1 A G 6: 22,999,633 D574G probably benign Het
Rnf40 G A 7: 127,596,406 D635N probably benign Het
Scn1a T A 2: 66,327,742 Q429L probably damaging Het
Sf1 G T 19: 6,374,097 G386C probably damaging Het
Shank2 A T 7: 144,409,894 Y623F probably damaging Het
Slc9a5 G T 8: 105,364,684 A699S probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Szt2 A G 4: 118,388,325 S1097P probably benign Het
Tmc1 C A 19: 20,795,610 E676* probably null Het
Ubr3 T C 2: 70,000,481 I158T possibly damaging Het
Ush2a T C 1: 188,356,792 Y315H probably damaging Het
Vmn1r85 T C 7: 13,084,644 D191G probably damaging Het
Zfp358 A G 8: 3,495,613 D92G probably benign Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Sox9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Sox9 APN 11 112784674 missense probably benign 0.00
IGL02257:Sox9 APN 11 112784985 missense possibly damaging 0.84
IGL02935:Sox9 APN 11 112785349 missense probably damaging 0.99
R0350:Sox9 UTSW 11 112784876 missense probably damaging 0.99
R0634:Sox9 UTSW 11 112784942 missense probably damaging 0.98
R4273:Sox9 UTSW 11 112785154 missense possibly damaging 0.60
R4692:Sox9 UTSW 11 112782977 missense probably benign 0.01
R5328:Sox9 UTSW 11 112782658 missense probably benign 0.39
R5501:Sox9 UTSW 11 112783859 missense probably damaging 1.00
R5905:Sox9 UTSW 11 112783820 missense probably damaging 1.00
R6707:Sox9 UTSW 11 112782872 missense probably damaging 0.99
R7897:Sox9 UTSW 11 112784809 missense probably benign 0.22
Z1176:Sox9 UTSW 11 112785122 missense possibly damaging 0.51
Z1177:Sox9 UTSW 11 112784803 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- TCCCGGGGTTTCATTGACC -3'
(R):5'- TTTTGAGCGCCCTGAACTGG -3'

Sequencing Primer
(F):5'- CCAGGCTGCTGAACGAGAG -3'
(R):5'- GGATGCAGAGAATAGTGTTTCCTTAC -3'
Posted On2018-09-12