Incidental Mutation 'R6834:Szt2'
ID534497
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Nameseizure threshold 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R6834 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location118362743-118409273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118388325 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1097 (S1097P)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
Predicted Effect probably benign
Transcript: ENSMUST00000075406
AA Change: S1097P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: S1097P

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,275,110 W530R possibly damaging Het
Aco1 A G 4: 40,164,747 K79R probably benign Het
Adam15 C T 3: 89,340,083 G426R probably damaging Het
Angptl1 A T 1: 156,844,693 I30L probably benign Het
Ankrd35 A G 3: 96,683,283 E295G possibly damaging Het
Ap5m1 T A 14: 49,073,737 V88E probably damaging Het
Astn1 A T 1: 158,664,122 Q47L probably benign Het
Atf6b T C 17: 34,649,157 S135P probably damaging Het
AU018091 T A 7: 3,157,955 I589F probably benign Het
BC052040 T C 2: 115,674,784 S179P probably benign Het
Cenpf T C 1: 189,659,446 K730E probably damaging Het
Chrna6 C T 8: 27,408,310 probably null Het
Dmxl1 A T 18: 49,955,823 I2790F probably damaging Het
Ell A G 8: 70,579,134 D116G probably damaging Het
Eml5 A T 12: 98,887,024 H105Q probably damaging Het
Epb41l2 T A 10: 25,493,604 V23D possibly damaging Het
Gatad2b T A 3: 90,348,643 S139T probably benign Het
Glb1l A G 1: 75,201,753 V347A possibly damaging Het
Gm4846 A T 1: 166,494,578 I140N possibly damaging Het
Gm7534 A C 4: 134,193,165 V563G possibly damaging Het
Gm9268 G C 7: 43,023,580 A143P probably damaging Het
Gng11 A G 6: 4,008,068 I44V probably benign Het
H2-Ke6 T C 17: 34,027,217 S161G probably damaging Het
Hsp90ab1 T C 17: 45,570,467 I250V probably benign Het
Igkv4-79 A G 6: 69,043,272 S20P probably damaging Het
Il11ra1 A G 4: 41,765,454 H183R probably benign Het
Kcnip3 A T 2: 127,458,358 F252I probably damaging Het
Klk11 T C 7: 43,778,912 I242T probably damaging Het
Klk12 T C 7: 43,773,348 V233A possibly damaging Het
Lama3 G A 18: 12,491,548 C1450Y probably damaging Het
Lmod2 A T 6: 24,597,783 probably benign Het
Loxhd1 T A 18: 77,441,526 V1089E probably damaging Het
Lrba C T 3: 86,350,286 P1286S probably benign Het
Lrrc41 T C 4: 116,096,529 V804A possibly damaging Het
Lrrc8a T A 2: 30,255,647 S158T possibly damaging Het
Mcm3 A T 1: 20,810,096 M504K possibly damaging Het
Med24 A T 11: 98,705,024 probably null Het
Mrgprx1 T C 7: 48,021,637 S121G probably damaging Het
Mvb12a G A 8: 71,545,252 M103I probably benign Het
Olfr726 A G 14: 50,084,228 V151A probably damaging Het
Olfr730 T C 14: 50,186,483 I245V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pacsin3 T A 2: 91,262,835 M224K probably damaging Het
Pam T A 1: 97,837,992 I771F probably damaging Het
Pamr1 C T 2: 102,614,931 R270C probably damaging Het
Pcdhgb8 G T 18: 37,762,089 A71S probably benign Het
Poc1b C T 10: 99,192,804 A336V probably benign Het
Prss39 G T 1: 34,498,616 V54F possibly damaging Het
Ptar1 A G 19: 23,717,924 T252A probably benign Het
Ptprz1 A G 6: 22,999,633 D574G probably benign Het
Rnf40 G A 7: 127,596,406 D635N probably benign Het
Scn1a T A 2: 66,327,742 Q429L probably damaging Het
Sf1 G T 19: 6,374,097 G386C probably damaging Het
Shank2 A T 7: 144,409,894 Y623F probably damaging Het
Slc9a5 G T 8: 105,364,684 A699S probably benign Het
Sox9 A T 11: 112,784,000 Q208L probably benign Het
Synpo2l A T 14: 20,660,634 D865E probably damaging Het
Tmc1 C A 19: 20,795,610 E676* probably null Het
Ubr3 T C 2: 70,000,481 I158T possibly damaging Het
Ush2a T C 1: 188,356,792 Y315H probably damaging Het
Vmn1r85 T C 7: 13,084,644 D191G probably damaging Het
Zfp358 A G 8: 3,495,613 D92G probably benign Het
Zfp735 G A 11: 73,710,608 G126D probably damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118384250 splice site probably benign
IGL01082:Szt2 APN 4 118397624 missense probably damaging 1.00
IGL01348:Szt2 APN 4 118393624 splice site probably benign
IGL01869:Szt2 APN 4 118399071 missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118384253 splice site probably benign
IGL01951:Szt2 APN 4 118376493 unclassified probably benign
IGL01971:Szt2 APN 4 118386955 missense probably benign 0.01
IGL02047:Szt2 APN 4 118376637 unclassified probably benign
IGL02092:Szt2 APN 4 118363332 unclassified probably benign
IGL02120:Szt2 APN 4 118388564 missense probably benign 0.01
IGL02210:Szt2 APN 4 118389823 missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118390823 missense probably damaging 1.00
IGL02622:Szt2 APN 4 118392890 missense probably damaging 0.96
IGL02666:Szt2 APN 4 118374055 missense probably damaging 0.99
IGL02712:Szt2 APN 4 118384833 missense probably benign 0.19
IGL02983:Szt2 APN 4 118365779 unclassified probably benign
IGL03026:Szt2 APN 4 118391849 missense probably benign 0.40
IGL03178:Szt2 APN 4 118382689 missense unknown
IGL03233:Szt2 APN 4 118372529 missense unknown
IGL03377:Szt2 APN 4 118402397 splice site probably benign
IGL03387:Szt2 APN 4 118364725 unclassified probably benign
PIT4687001:Szt2 UTSW 4 118398201 missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118384772 missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118382593 missense unknown
R0396:Szt2 UTSW 4 118376347 unclassified probably benign
R0504:Szt2 UTSW 4 118372952 splice site probably null
R1033:Szt2 UTSW 4 118387106 missense probably damaging 0.98
R1222:Szt2 UTSW 4 118405459 missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118387779 missense probably benign 0.03
R1462:Szt2 UTSW 4 118373967 missense unknown
R1462:Szt2 UTSW 4 118373967 missense unknown
R1763:Szt2 UTSW 4 118372368 missense unknown
R1772:Szt2 UTSW 4 118405517 missense probably damaging 1.00
R1840:Szt2 UTSW 4 118365657 unclassified probably benign
R1942:Szt2 UTSW 4 118392620 missense probably benign 0.17
R1965:Szt2 UTSW 4 118383965 missense probably benign 0.36
R1998:Szt2 UTSW 4 118375727 critical splice donor site probably null
R2009:Szt2 UTSW 4 118378064 critical splice donor site probably null
R2012:Szt2 UTSW 4 118363665 unclassified probably benign
R2044:Szt2 UTSW 4 118376448 nonsense probably null
R2066:Szt2 UTSW 4 118373980 missense unknown
R2345:Szt2 UTSW 4 118381397 missense unknown
R2857:Szt2 UTSW 4 118369402 missense probably damaging 1.00
R3156:Szt2 UTSW 4 118402819 critical splice donor site probably null
R3236:Szt2 UTSW 4 118383034 splice site probably null
R3237:Szt2 UTSW 4 118383034 splice site probably null
R3405:Szt2 UTSW 4 118394020 missense probably benign 0.02
R3795:Szt2 UTSW 4 118391730 missense probably damaging 1.00
R3878:Szt2 UTSW 4 118390585 missense probably damaging 1.00
R3906:Szt2 UTSW 4 118378269 unclassified probably benign
R4012:Szt2 UTSW 4 118383900 missense probably benign 0.02
R4039:Szt2 UTSW 4 118364952 unclassified probably benign
R4081:Szt2 UTSW 4 118373567 splice site probably benign
R4298:Szt2 UTSW 4 118365406 unclassified probably benign
R4299:Szt2 UTSW 4 118365406 unclassified probably benign
R4432:Szt2 UTSW 4 118384231 missense probably damaging 0.99
R4597:Szt2 UTSW 4 118372681 missense unknown
R4657:Szt2 UTSW 4 118397669 missense probably benign 0.06
R4663:Szt2 UTSW 4 118377684 unclassified probably benign
R4670:Szt2 UTSW 4 118375829 unclassified probably benign
R4704:Szt2 UTSW 4 118393829 missense probably damaging 0.99
R4748:Szt2 UTSW 4 118389191 nonsense probably null
R4786:Szt2 UTSW 4 118399062 missense probably benign 0.20
R4809:Szt2 UTSW 4 118388985 missense probably damaging 1.00
R4830:Szt2 UTSW 4 118369248 missense unknown
R4944:Szt2 UTSW 4 118388669 missense probably benign 0.03
R5077:Szt2 UTSW 4 118369616 critical splice donor site probably null
R5121:Szt2 UTSW 4 118385444 missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118386981 missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118389830 missense probably benign 0.26
R5198:Szt2 UTSW 4 118388322 missense probably benign 0.03
R5433:Szt2 UTSW 4 118375466 unclassified probably benign
R5625:Szt2 UTSW 4 118373217 missense unknown
R5628:Szt2 UTSW 4 118373217 missense unknown
R5630:Szt2 UTSW 4 118392905 missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118372613 missense unknown
R5902:Szt2 UTSW 4 118391503 missense probably benign 0.05
R6049:Szt2 UTSW 4 118402988 missense probably damaging 0.99
R6066:Szt2 UTSW 4 118371974 missense unknown
R6272:Szt2 UTSW 4 118374290 unclassified probably benign
R6456:Szt2 UTSW 4 118376697 unclassified probably benign
R6538:Szt2 UTSW 4 118390477 splice site probably null
R6604:Szt2 UTSW 4 118385474 missense probably benign 0.01
R6664:Szt2 UTSW 4 118391745 missense probably damaging 1.00
R7109:Szt2 UTSW 4 118375479 missense unknown
R7163:Szt2 UTSW 4 118405530 missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118389006 missense probably damaging 0.98
R7289:Szt2 UTSW 4 118375878 missense unknown
R7291:Szt2 UTSW 4 118391249 missense probably damaging 0.98
R7383:Szt2 UTSW 4 118365214 nonsense probably null
R7448:Szt2 UTSW 4 118363471 missense unknown
R7637:Szt2 UTSW 4 118393828 missense probably damaging 0.99
X0023:Szt2 UTSW 4 118372404 missense unknown
Predicted Primers PCR Primer
(F):5'- AGACCTGAGAACTCCAGGAATC -3'
(R):5'- CATTGCTGAGACAGAGTGTGTG -3'

Sequencing Primer
(F):5'- TCCAGGAATCACTACACTCTGTAAG -3'
(R):5'- AACGACATGGTGCTGTGC -3'
Posted On2018-09-12