Mutagenetix > Incidental Mutation

Incidental Mutation 'R6834:Szt2'

534497

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R6834 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118388325 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1097 (S1097P)

Ref Sequence

ENSEMBL: ENSMUSP00000074862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000075406
AA Change: S1097P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: S1097P

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,275,110	W530R	possibly damaging	Het
Aco1	A	G	4: 40,164,747	K79R	probably benign	Het
Adam15	C	T	3: 89,340,083	G426R	probably damaging	Het
Angptl1	A	T	1: 156,844,693	I30L	probably benign	Het
Ankrd35	A	G	3: 96,683,283	E295G	possibly damaging	Het
Ap5m1	T	A	14: 49,073,737	V88E	probably damaging	Het
Astn1	A	T	1: 158,664,122	Q47L	probably benign	Het
Atf6b	T	C	17: 34,649,157	S135P	probably damaging	Het
AU018091	T	A	7: 3,157,955	I589F	probably benign	Het
BC052040	T	C	2: 115,674,784	S179P	probably benign	Het
Cenpf	T	C	1: 189,659,446	K730E	probably damaging	Het
Chrna6	C	T	8: 27,408,310		probably null	Het
Dmxl1	A	T	18: 49,955,823	I2790F	probably damaging	Het
Ell	A	G	8: 70,579,134	D116G	probably damaging	Het
Eml5	A	T	12: 98,887,024	H105Q	probably damaging	Het
Epb41l2	T	A	10: 25,493,604	V23D	possibly damaging	Het
Gatad2b	T	A	3: 90,348,643	S139T	probably benign	Het
Glb1l	A	G	1: 75,201,753	V347A	possibly damaging	Het
Gm4846	A	T	1: 166,494,578	I140N	possibly damaging	Het
Gm7534	A	C	4: 134,193,165	V563G	possibly damaging	Het
Gm9268	G	C	7: 43,023,580	A143P	probably damaging	Het
Gng11	A	G	6: 4,008,068	I44V	probably benign	Het
H2-Ke6	T	C	17: 34,027,217	S161G	probably damaging	Het
Hsp90ab1	T	C	17: 45,570,467	I250V	probably benign	Het
Igkv4-79	A	G	6: 69,043,272	S20P	probably damaging	Het
Il11ra1	A	G	4: 41,765,454	H183R	probably benign	Het
Kcnip3	A	T	2: 127,458,358	F252I	probably damaging	Het
Klk11	T	C	7: 43,778,912	I242T	probably damaging	Het
Klk12	T	C	7: 43,773,348	V233A	possibly damaging	Het
Lama3	G	A	18: 12,491,548	C1450Y	probably damaging	Het
Lmod2	A	T	6: 24,597,783		probably benign	Het
Loxhd1	T	A	18: 77,441,526	V1089E	probably damaging	Het
Lrba	C	T	3: 86,350,286	P1286S	probably benign	Het
Lrrc41	T	C	4: 116,096,529	V804A	possibly damaging	Het
Lrrc8a	T	A	2: 30,255,647	S158T	possibly damaging	Het
Mcm3	A	T	1: 20,810,096	M504K	possibly damaging	Het
Med24	A	T	11: 98,705,024		probably null	Het
Mrgprx1	T	C	7: 48,021,637	S121G	probably damaging	Het
Mvb12a	G	A	8: 71,545,252	M103I	probably benign	Het
Olfr726	A	G	14: 50,084,228	V151A	probably damaging	Het
Olfr730	T	C	14: 50,186,483	I245V	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pacsin3	T	A	2: 91,262,835	M224K	probably damaging	Het
Pam	T	A	1: 97,837,992	I771F	probably damaging	Het
Pamr1	C	T	2: 102,614,931	R270C	probably damaging	Het
Pcdhgb8	G	T	18: 37,762,089	A71S	probably benign	Het
Poc1b	C	T	10: 99,192,804	A336V	probably benign	Het
Prss39	G	T	1: 34,498,616	V54F	possibly damaging	Het
Ptar1	A	G	19: 23,717,924	T252A	probably benign	Het
Ptprz1	A	G	6: 22,999,633	D574G	probably benign	Het
Rnf40	G	A	7: 127,596,406	D635N	probably benign	Het
Scn1a	T	A	2: 66,327,742	Q429L	probably damaging	Het
Sf1	G	T	19: 6,374,097	G386C	probably damaging	Het
Shank2	A	T	7: 144,409,894	Y623F	probably damaging	Het
Slc9a5	G	T	8: 105,364,684	A699S	probably benign	Het
Sox9	A	T	11: 112,784,000	Q208L	probably benign	Het
Synpo2l	A	T	14: 20,660,634	D865E	probably damaging	Het
Tmc1	C	A	19: 20,795,610	E676*	probably null	Het
Ubr3	T	C	2: 70,000,481	I158T	possibly damaging	Het
Ush2a	T	C	1: 188,356,792	Y315H	probably damaging	Het
Vmn1r85	T	C	7: 13,084,644	D191G	probably damaging	Het
Zfp358	A	G	8: 3,495,613	D92G	probably benign	Het
Zfp735	G	A	11: 73,710,608	G126D	probably damaging	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4670:Szt2	UTSW	4	118375829	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACCTGAGAACTCCAGGAATC -3'
(R):5'- CATTGCTGAGACAGAGTGTGTG -3'

Sequencing Primer
(F):5'- TCCAGGAATCACTACACTCTGTAAG -3'
(R):5'- AACGACATGGTGCTGTGC -3'

Posted On

2018-09-12