Incidental Mutation 'R6845:Rnf133'
ID534709
Institutional Source Beutler Lab
Gene Symbol Rnf133
Ensembl Gene ENSMUSG00000051956
Gene Namering finger protein 133
SynonymsGreul2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6845 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location23648869-23650305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23649342 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 196 (V196A)
Ref Sequence ENSEMBL: ENSMUSP00000066906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000063548] [ENSMUST00000069074] [ENSMUST00000104979] [ENSMUST00000115354] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
Predicted Effect probably benign
Transcript: ENSMUST00000018122
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000063548
AA Change: V196A

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066906
Gene: ENSMUSG00000051956
AA Change: V196A

DomainStartEndE-ValueType
Pfam:PA 94 162 3.6e-11 PFAM
RING 213 253 6.43e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069074
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000104979
SMART Domains Protein: ENSMUSP00000100592
Gene: ENSMUSG00000078179

DomainStartEndE-ValueType
low complexity region 25 43 N/A INTRINSIC
Pfam:PA 82 178 1e-13 PFAM
RING 269 309 1.82e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115354
AA Change: V239A

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111011
Gene: ENSMUSG00000051956
AA Change: V239A

DomainStartEndE-ValueType
Pfam:PA 70 165 1.9e-13 PFAM
RING 256 296 6.43e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115356
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115358
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115361
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142913
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163871
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 95% (53/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions. This gene has no intron. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,904 S1887P possibly damaging Het
Adam6a T C 12: 113,544,097 L30P possibly damaging Het
Cabin1 G A 10: 75,721,508 R1099W probably damaging Het
Cdon C T 9: 35,486,956 Q990* probably null Het
Cit T A 5: 115,984,888 L1421Q probably damaging Het
Ddx27 T C 2: 167,022,096 C242R probably damaging Het
Dlgap5 A T 14: 47,416,563 V3E possibly damaging Het
Dnah6 A T 6: 73,133,542 F1687I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Duoxa1 A T 2: 122,305,191 Y142* probably null Het
F3 A G 3: 121,732,475 K229R probably benign Het
Fance A G 17: 28,317,591 R42G probably damaging Het
Foxs1 T C 2: 152,932,699 K145E probably benign Het
Gm5538 C A 3: 59,752,118 P331T probably damaging Het
Gpd1l T C 9: 114,933,717 M1V probably null Het
Gpr149 T A 3: 62,604,521 H19L possibly damaging Het
Hmgcs1 T C 13: 119,701,138 Y213H probably damaging Het
Htra1 C A 7: 130,936,291 probably benign Het
Il20ra A G 10: 19,759,311 I433M probably benign Het
Il3ra G C 14: 14,346,517 probably null Het
Kif11 C T 19: 37,404,117 L499F probably damaging Het
Kifc3 A G 8: 95,108,679 M189T probably benign Het
Klk1b3 G A 7: 44,201,703 A187T probably benign Het
Klre1 T C 6: 129,584,239 S188P probably damaging Het
Krtap4-13 G A 11: 99,809,366 probably benign Het
Lgi4 A T 7: 31,061,085 T22S probably damaging Het
Lrp10 C T 14: 54,469,688 R661C probably damaging Het
Lrrtm1 A G 6: 77,243,881 D107G probably benign Het
Mad1l1 C A 5: 140,009,169 A701S probably damaging Het
Mia2 T A 12: 59,184,278 Y1237* probably null Het
Mpp4 T C 1: 59,144,804 D278G probably benign Het
Myh6 G A 14: 54,944,749 S1734L probably benign Het
Nbeal1 C T 1: 60,281,310 R2021* probably null Het
Nol4l T C 2: 153,416,662 T602A probably benign Het
Olfr1463 T A 19: 13,234,633 C128S probably damaging Het
Pcdh15 A T 10: 74,630,633 H894L probably benign Het
Phldb1 A T 9: 44,716,062 I362N probably damaging Het
Plcxd2 T A 16: 46,009,860 probably benign Het
Ppp1r13l G T 7: 19,371,398 R365L probably damaging Het
Pramef25 T C 4: 143,949,824 T237A probably benign Het
Rfc1 A T 5: 65,311,116 S85T possibly damaging Het
Shank3 T C 15: 89,548,325 V1016A probably benign Het
Slc22a21 T C 11: 53,979,640 D73G probably benign Het
Slc34a2 T A 5: 53,069,169 F545I probably damaging Het
Slc4a7 T A 14: 14,775,000 M810K probably damaging Het
Ss18 A T 18: 14,655,164 M83K possibly damaging Het
Tkfc T C 19: 10,599,332 R94G probably damaging Het
Tpp2 T A 1: 43,978,508 C757* probably null Het
Trav13n-4 T C 14: 53,362,399 L11P probably damaging Het
Trpm4 T C 7: 45,322,329 M138V possibly damaging Het
Utp18 G A 11: 93,885,756 probably benign Het
Vps33a A G 5: 123,535,272 V417A probably benign Het
Zfp207 C T 11: 80,395,491 probably benign Het
Other mutations in Rnf133
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Rnf133 APN 6 23649256 missense probably benign 0.00
IGL01907:Rnf133 APN 6 23649304 missense probably benign 0.04
IGL01972:Rnf133 APN 6 23648989 missense probably benign 0.00
IGL03025:Rnf133 APN 6 23649135 missense probably benign 0.03
R0682:Rnf133 UTSW 6 23649570 missense probably damaging 1.00
R2251:Rnf133 UTSW 6 23649175 missense probably benign 0.01
R2253:Rnf133 UTSW 6 23649175 missense probably benign 0.01
R2970:Rnf133 UTSW 6 23649406 missense probably benign 0.17
R4204:Rnf133 UTSW 6 23649049 missense probably benign 0.00
R4600:Rnf133 UTSW 6 23649042 missense possibly damaging 0.86
R4601:Rnf133 UTSW 6 23649042 missense possibly damaging 0.86
R5123:Rnf133 UTSW 6 23649260 missense probably damaging 0.99
R6877:Rnf133 UTSW 6 23649487 missense probably benign 0.01
R7263:Rnf133 UTSW 6 23649668 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCCAGAGCTTTCAGAATG -3'
(R):5'- CATGTTACAGTCATGGTGGAGG -3'

Sequencing Primer
(F):5'- AATGTCACATTTGCACATGGGGC -3'
(R):5'- GTGGGAAGAAAACATGTCATTTGGC -3'
Posted On2018-09-12