Incidental Mutation 'R6846:Nfya'
ID534784
Institutional Source Beutler Lab
Gene Symbol Nfya
Ensembl Gene ENSMUSG00000023994
Gene Namenuclear transcription factor-Y alpha
SynonymsSez10, Cbf-b
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6846 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location48386885-48409906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48395687 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 62 (M62K)
Ref Sequence ENSEMBL: ENSMUSP00000123785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046719] [ENSMUST00000078800] [ENSMUST00000159063] [ENSMUST00000159535] [ENSMUST00000160319] [ENSMUST00000161117] [ENSMUST00000161256] [ENSMUST00000162460]
Predicted Effect unknown
Transcript: ENSMUST00000046719
AA Change: M91K
SMART Domains Protein: ENSMUSP00000043909
Gene: ENSMUSG00000023994
AA Change: M91K

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 99 167 N/A INTRINSIC
low complexity region 205 223 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
CBF 260 321 3.92e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000078800
AA Change: M90K
SMART Domains Protein: ENSMUSP00000077853
Gene: ENSMUSG00000023994
AA Change: M90K

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 38 57 N/A INTRINSIC
low complexity region 98 166 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 225 239 N/A INTRINSIC
CBF 259 320 3.92e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159063
AA Change: M62K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124404
Gene: ENSMUSG00000023994
AA Change: M62K

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
low complexity region 70 138 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 191 205 N/A INTRINSIC
CBF 225 286 3.92e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159237
SMART Domains Protein: ENSMUSP00000124115
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 66 84 N/A INTRINSIC
low complexity region 87 101 N/A INTRINSIC
CBF 121 182 3.92e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159535
AA Change: M89K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124501
Gene: ENSMUSG00000023994
AA Change: M89K

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
internal_repeat_1 57 82 3.82e-6 PROSPERO
internal_repeat_1 74 95 3.82e-6 PROSPERO
low complexity region 97 165 N/A INTRINSIC
low complexity region 197 215 N/A INTRINSIC
low complexity region 218 232 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000160319
AA Change: M91K
SMART Domains Protein: ENSMUSP00000124245
Gene: ENSMUSG00000023994
AA Change: M91K

DomainStartEndE-ValueType
low complexity region 14 37 N/A INTRINSIC
low complexity region 39 58 N/A INTRINSIC
low complexity region 99 167 N/A INTRINSIC
low complexity region 199 217 N/A INTRINSIC
low complexity region 220 234 N/A INTRINSIC
CBF 254 315 3.92e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161117
AA Change: M56K
SMART Domains Protein: ENSMUSP00000124965
Gene: ENSMUSG00000023994
AA Change: M56K

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
internal_repeat_1 24 49 2.33e-5 PROSPERO
internal_repeat_1 41 62 2.33e-5 PROSPERO
low complexity region 64 132 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 191 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161256
SMART Domains Protein: ENSMUSP00000125034
Gene: ENSMUSG00000023994

DomainStartEndE-ValueType
low complexity region 1 33 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
CBF 124 185 9.8e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162460
AA Change: M62K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123785
Gene: ENSMUSG00000023994
AA Change: M62K

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
low complexity region 70 138 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 197 211 N/A INTRINSIC
CBF 231 292 3.92e-35 SMART
Meta Mutation Damage Score 0.1815 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds to CCAAT motifs in the promoter regions in a variety of genes. Subunit A associates with a tight dimer composed of the B and C subunits, resulting in a trimer that binds to DNA with high specificity and affinity. The sequence specific interactions of the complex are made by the A subunit, suggesting a role as the regulatory subunit. In addition, there is evidence of post-transcriptional regulation in this gene product, either by protein degradation or control of translation. Further regulation is represented by alternative splicing in the glutamine-rich activation domain, with clear tissue-specific preferences for the two isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inactivation of this locus impairs development and results in embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,011,857 N3502D possibly damaging Het
AI314180 A G 4: 58,814,081 C1342R possibly damaging Het
Ambn T A 5: 88,461,715 I94K possibly damaging Het
Ank3 A G 10: 69,824,349 H227R probably damaging Het
Arhgap42 G T 9: 9,006,445 P650Q probably damaging Het
Bahcc1 A G 11: 120,271,596 E240G possibly damaging Het
Cd19 T C 7: 126,410,853 E408G probably benign Het
Cdh11 G A 8: 102,664,644 T320I probably damaging Het
Cep131 G A 11: 120,065,691 R944W probably damaging Het
Dgkd T G 1: 87,925,691 probably null Het
Dnaaf1 T A 8: 119,582,662 L163Q probably damaging Het
Etl4 T A 2: 20,744,108 L550Q possibly damaging Het
Evpl T C 11: 116,223,807 E1019G probably damaging Het
Fam120b T C 17: 15,414,829 L601P probably damaging Het
Fhit C A 14: 9,763,762 R172L possibly damaging Het
Hoxa6 T C 6: 52,206,543 H174R possibly damaging Het
Htra4 A G 8: 25,030,545 F367L probably damaging Het
Ighg2c A G 12: 113,288,310 I102T unknown Het
Iws1 T C 18: 32,086,273 probably benign Het
Lats2 A G 14: 57,696,134 V842A probably damaging Het
Limd2 C T 11: 106,159,387 M1I probably null Het
Lrp2 T A 2: 69,518,443 Q728L probably damaging Het
Mcc T A 18: 44,473,640 T400S possibly damaging Het
Mthfd1l A G 10: 4,047,898 D623G probably damaging Het
Myocos T C 1: 162,657,096 probably benign Het
Nat1 G T 8: 67,491,343 A124S probably benign Het
Nlgn1 A G 3: 25,436,342 V378A probably damaging Het
Olfr584 T A 7: 103,086,058 I175N possibly damaging Het
Olfr992 A T 2: 85,400,517 N5K probably damaging Het
Pitpnm2 T C 5: 124,131,171 S463G probably benign Het
Serpinb3b T C 1: 107,154,673 E287G probably benign Het
Slc16a13 T C 11: 70,217,835 T390A probably benign Het
Slc7a14 A G 3: 31,224,223 M411T probably damaging Het
Strn A G 17: 78,736,457 F11L probably damaging Het
Swap70 T A 7: 110,255,749 F85L possibly damaging Het
Tanc2 T A 11: 105,798,653 W214R probably benign Het
Tenm3 T C 8: 48,276,738 K1411R probably benign Het
Tmem176a G T 6: 48,843,825 R116L probably damaging Het
Trim71 G T 9: 114,525,047 H296Q probably damaging Het
Vmn1r67 A T 7: 10,446,913 I35L probably benign Het
Vnn3 A G 10: 23,851,722 T47A probably benign Het
Zscan10 A T 17: 23,605,607 Q12H probably damaging Het
Other mutations in Nfya
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Nfya APN 17 48393255 unclassified probably benign
IGL02348:Nfya APN 17 48393276 nonsense probably null
IGL03220:Nfya APN 17 48400493 missense possibly damaging 0.66
IGL03274:Nfya APN 17 48391347 missense probably damaging 1.00
PIT4468001:Nfya UTSW 17 48395777 missense unknown
R0147:Nfya UTSW 17 48398998 missense possibly damaging 0.46
R0148:Nfya UTSW 17 48398998 missense possibly damaging 0.46
R0904:Nfya UTSW 17 48395787 nonsense probably null
R1484:Nfya UTSW 17 48393542 unclassified probably benign
R4105:Nfya UTSW 17 48392884 nonsense probably null
R4108:Nfya UTSW 17 48392884 nonsense probably null
R4109:Nfya UTSW 17 48392884 nonsense probably null
R4923:Nfya UTSW 17 48400535 utr 5 prime probably benign
R5411:Nfya UTSW 17 48392018 missense possibly damaging 0.83
R6299:Nfya UTSW 17 48392910 intron probably benign
R6967:Nfya UTSW 17 48392904 intron probably benign
R7027:Nfya UTSW 17 48389312 missense probably benign 0.00
R7634:Nfya UTSW 17 48392417 missense probably damaging 0.99
Z1177:Nfya UTSW 17 48393513 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGAATTCATGGCAGCCCTG -3'
(R):5'- TGATTGATCATCTTTGTGAAGCTGC -3'

Sequencing Primer
(F):5'- GGCTCCCAGACTACAGCTAG -3'
(R):5'- TGAAGCTGCTTGTGTCTGAC -3'
Posted On2018-09-12