Incidental Mutation 'R6849:Eif4g1'
ID534940
Institutional Source Beutler Lab
Gene Symbol Eif4g1
Ensembl Gene ENSMUSG00000045983
Gene Nameeukaryotic translation initiation factor 4, gamma 1
SynonymsE030015G23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R6849 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20668313-20692884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20680745 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 515 (I515V)
Ref Sequence ENSEMBL: ENSMUSP00000111123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044783] [ENSMUST00000073840] [ENSMUST00000115457] [ENSMUST00000115460] [ENSMUST00000115461] [ENSMUST00000115463] [ENSMUST00000128594] [ENSMUST00000128840] [ENSMUST00000136713] [ENSMUST00000140576] [ENSMUST00000141034] [ENSMUST00000142344] [ENSMUST00000143939] [ENSMUST00000150333] [ENSMUST00000151679] [ENSMUST00000154594] [ENSMUST00000154950] [ENSMUST00000156226] [ENSMUST00000231618]
Predicted Effect probably benign
Transcript: ENSMUST00000044783
AA Change: I522V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047678
Gene: ENSMUSG00000045983
AA Change: I522V

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073840
AA Change: I515V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073506
Gene: ENSMUSG00000045983
AA Change: I515V

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1028 1040 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1150 1171 N/A INTRINSIC
low complexity region 1179 1194 N/A INTRINSIC
MA3 1235 1347 3.83e-39 SMART
low complexity region 1434 1445 N/A INTRINSIC
eIF5C 1501 1588 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115457
AA Change: I475V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000111117
Gene: ENSMUSG00000045983
AA Change: I475V

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
PDB:1LJ2|D 132 159 9e-11 PDB
low complexity region 213 239 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
low complexity region 417 440 N/A INTRINSIC
Blast:MIF4G 591 636 7e-9 BLAST
low complexity region 638 660 N/A INTRINSIC
MIF4G 718 946 5.14e-72 SMART
low complexity region 988 1000 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1110 1131 N/A INTRINSIC
low complexity region 1139 1154 N/A INTRINSIC
MA3 1195 1307 3.83e-39 SMART
low complexity region 1394 1405 N/A INTRINSIC
eIF5C 1461 1548 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115460
AA Change: I522V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000111120
Gene: ENSMUSG00000045983
AA Change: I522V

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115461
AA Change: I515V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000111121
Gene: ENSMUSG00000045983
AA Change: I515V

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 8e-9 BLAST
low complexity region 678 693 N/A INTRINSIC
MIF4G 759 987 5.14e-72 SMART
low complexity region 1029 1041 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
low complexity region 1151 1172 N/A INTRINSIC
low complexity region 1180 1195 N/A INTRINSIC
MA3 1236 1348 3.83e-39 SMART
low complexity region 1435 1446 N/A INTRINSIC
eIF5C 1502 1589 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115463
AA Change: I515V

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111123
Gene: ENSMUSG00000045983
AA Change: I515V

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1030 1036 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1143 1164 N/A INTRINSIC
low complexity region 1172 1187 N/A INTRINSIC
MA3 1228 1340 3.83e-39 SMART
low complexity region 1427 1438 N/A INTRINSIC
eIF5C 1494 1581 3.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128594
AA Change: I351V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144594
Gene: ENSMUSG00000045983
AA Change: I351V

DomainStartEndE-ValueType
PDB:1LJ2|D 8 35 5e-11 PDB
low complexity region 89 115 N/A INTRINSIC
low complexity region 265 286 N/A INTRINSIC
low complexity region 293 316 N/A INTRINSIC
Blast:MIF4G 467 512 4e-9 BLAST
low complexity region 514 536 N/A INTRINSIC
MIF4G 594 795 1.1e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128840
SMART Domains Protein: ENSMUSP00000143861
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
PDB:1LJ2|D 85 112 5e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000136713
SMART Domains Protein: ENSMUSP00000143999
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
PDB:1LJ2|D 85 112 3e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000140576
SMART Domains Protein: ENSMUSP00000117587
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 20 41 N/A INTRINSIC
PDB:1LJ2|D 129 156 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000141034
SMART Domains Protein: ENSMUSP00000120035
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:4F02|F 175 200 4e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000142344
AA Change: I515V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116029
Gene: ENSMUSG00000045983
AA Change: I515V

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 5e-11 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 672 6e-8 BLAST
low complexity region 678 693 N/A INTRINSIC
MIF4G 759 958 5.49e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143939
AA Change: I225V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144320
Gene: ENSMUSG00000045983
AA Change: I225V

DomainStartEndE-ValueType
low complexity region 139 160 N/A INTRINSIC
low complexity region 167 190 N/A INTRINSIC
Blast:MIF4G 341 386 6e-9 BLAST
low complexity region 388 410 N/A INTRINSIC
MIF4G 468 696 2.2e-74 SMART
low complexity region 738 750 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 860 881 N/A INTRINSIC
low complexity region 889 904 N/A INTRINSIC
MA3 945 1057 1.7e-41 SMART
low complexity region 1144 1155 N/A INTRINSIC
eIF5C 1211 1298 1.8e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150333
AA Change: I456V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144107
Gene: ENSMUSG00000045983
AA Change: I456V

DomainStartEndE-ValueType
PDB:1LJ2|D 113 140 5e-11 PDB
low complexity region 194 220 N/A INTRINSIC
low complexity region 370 391 N/A INTRINSIC
low complexity region 398 421 N/A INTRINSIC
Blast:MIF4G 572 613 9e-8 BLAST
low complexity region 619 641 N/A INTRINSIC
MIF4G 699 900 1.1e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151679
SMART Domains Protein: ENSMUSP00000120698
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
PDB:1LJ2|D 132 159 8e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154594
SMART Domains Protein: ENSMUSP00000144233
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
PDB:1LJ2|D 8 35 3e-12 PDB
low complexity region 89 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154950
SMART Domains Protein: ENSMUSP00000115230
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156226
SMART Domains Protein: ENSMUSP00000119215
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231598
Predicted Effect probably benign
Transcript: ENSMUST00000231618
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: This gene encodes a member of the eukaryotic translation initiation factors (eIF) that play important roles in translation initiation by mediating recruitment of additional initiation factors and providing a scaffold for ribosome/mRNA-bridging. Along with eIF4A and eIF4E, the encoded protein forms the eIF4F complex that bridges the 5' UTR with the polyadenylated 3' UTR resulting in mRNA circularization, enhanced translation initiation and mRNA stability. Through its association with eIF3, the encoded protein mediates recruitment of the 43S pre-initiation complex to mRNA. Alternative splicing of this gene results in multiple transcript variants. Pseudogenes for this gene have been identified on chromosomes 2 and 13. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an amino acid substitution (R1207H) are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik G T 8: 124,639,522 Q161K probably damaging Het
4930578I06Rik A T 14: 63,986,238 W30R probably damaging Het
4930578I06Rik G T 14: 63,986,239 N29K probably benign Het
Aldh6a1 A G 12: 84,443,787 V18A probably benign Het
Apoa5 A G 9: 46,270,000 K125E probably benign Het
Bphl T A 13: 34,050,269 probably null Het
C2cd3 T A 7: 100,406,927 V514E probably damaging Het
C530008M17Rik C A 5: 76,857,010 A406E unknown Het
C530008M17Rik C T 5: 76,857,157 A455V unknown Het
Cacna1s G A 1: 136,092,694 R823Q probably benign Het
Cep192 A G 18: 67,812,435 D202G probably benign Het
Chd5 A T 4: 152,378,538 N1420Y probably damaging Het
Cnot10 A T 9: 114,631,936 D55E probably benign Het
Cntn1 T A 15: 92,305,246 I803N probably damaging Het
Col7a1 G T 9: 108,975,053 V2217L unknown Het
Cpne9 T G 6: 113,302,118 V491G probably damaging Het
Csnk2a1 C A 2: 152,250,564 H18Q probably benign Het
D130040H23Rik T A 8: 69,302,651 Y253* probably null Het
Dnah14 A T 1: 181,808,945 M4321L probably benign Het
Dnah5 A G 15: 28,278,624 T1122A probably benign Het
Fam214a A C 9: 75,009,312 N398H probably damaging Het
Fbn1 T C 2: 125,321,691 K2082E possibly damaging Het
Fstl1 A G 16: 37,821,159 K99R probably benign Het
Gar1 T C 3: 129,829,389 N117S probably damaging Het
Gm3238 A T 10: 77,770,910 probably benign Het
Gm32742 C T 9: 51,138,714 M1528I probably benign Het
H2-T3 T C 17: 36,189,805 I49V probably benign Het
Hyou1 A G 9: 44,387,264 I581V probably damaging Het
Itk T C 11: 46,331,935 N563S probably damaging Het
Lingo1 A G 9: 56,619,616 L563P probably damaging Het
Lipc A G 9: 70,818,847 probably null Het
Map4k3 A C 17: 80,630,413 probably null Het
Mctp2 C T 7: 72,211,718 C393Y probably damaging Het
Mei1 T A 15: 82,079,945 L229M possibly damaging Het
Olfr1501 G T 19: 13,838,839 C111* probably null Het
Olfr309 T C 7: 86,307,040 I24M possibly damaging Het
Pcnx2 A G 8: 125,861,210 V833A probably damaging Het
Pde8b T C 13: 95,047,799 N388D possibly damaging Het
Pi4ka G A 16: 17,303,421 A1197V possibly damaging Het
Psd A G 19: 46,317,746 Y36H probably damaging Het
Scn8a T A 15: 100,955,587 probably null Het
Shisa6 A G 11: 66,525,501 V155A probably benign Het
Slc45a3 T A 1: 131,977,964 C242S probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Tmc3 T A 7: 83,586,357 I54K probably damaging Het
Tmprss11g T A 5: 86,496,632 I118F probably benign Het
Ttn T A 2: 76,914,343 D5454V possibly damaging Het
Ube2f A G 1: 91,254,213 probably null Het
Ubr7 T C 12: 102,758,083 S19P probably damaging Het
Vav3 T C 3: 109,521,466 V371A probably damaging Het
Vmn2r28 A G 7: 5,480,807 V798A probably damaging Het
Vmn2r95 T G 17: 18,443,919 C467G probably damaging Het
Vmn2r95 G T 17: 18,443,920 C467F probably damaging Het
Vps13b A G 15: 35,905,309 D3325G probably damaging Het
Wnk2 T C 13: 49,067,358 T1158A probably damaging Het
Zfp616 T A 11: 74,085,450 N848K possibly damaging Het
Other mutations in Eif4g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Eif4g1 APN 16 20686754 intron probably benign
IGL00707:Eif4g1 APN 16 20689014 missense probably damaging 1.00
IGL00950:Eif4g1 APN 16 20683628 missense probably damaging 1.00
IGL01397:Eif4g1 APN 16 20679675 missense probably damaging 0.98
IGL01657:Eif4g1 APN 16 20682216 missense possibly damaging 0.94
IGL01875:Eif4g1 APN 16 20681040 missense probably damaging 0.96
IGL02728:Eif4g1 APN 16 20686752 intron probably benign
IGL03155:Eif4g1 APN 16 20692417 missense probably damaging 1.00
IGL03339:Eif4g1 APN 16 20680984 missense possibly damaging 0.72
R0032:Eif4g1 UTSW 16 20685898 missense probably damaging 1.00
R0032:Eif4g1 UTSW 16 20685898 missense probably damaging 1.00
R0138:Eif4g1 UTSW 16 20675345 missense probably damaging 0.99
R0556:Eif4g1 UTSW 16 20675794 missense probably damaging 0.99
R0576:Eif4g1 UTSW 16 20684068 missense probably damaging 0.98
R1424:Eif4g1 UTSW 16 20678942 missense probably benign 0.03
R1469:Eif4g1 UTSW 16 20680008 missense possibly damaging 0.86
R1469:Eif4g1 UTSW 16 20680008 missense possibly damaging 0.86
R1487:Eif4g1 UTSW 16 20678873 unclassified probably benign
R1659:Eif4g1 UTSW 16 20681061 missense probably damaging 0.99
R1697:Eif4g1 UTSW 16 20679780 missense probably damaging 0.99
R1848:Eif4g1 UTSW 16 20681867 missense probably damaging 1.00
R1855:Eif4g1 UTSW 16 20687161 missense possibly damaging 0.77
R1865:Eif4g1 UTSW 16 20678648 missense probably damaging 0.99
R3001:Eif4g1 UTSW 16 20692384 missense probably damaging 1.00
R3002:Eif4g1 UTSW 16 20692384 missense probably damaging 1.00
R4402:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4477:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4478:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4479:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4480:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4623:Eif4g1 UTSW 16 20681345 unclassified probably benign
R4658:Eif4g1 UTSW 16 20685934 missense possibly damaging 0.78
R4751:Eif4g1 UTSW 16 20686515 missense possibly damaging 0.89
R4859:Eif4g1 UTSW 16 20682173 missense probably benign 0.44
R5267:Eif4g1 UTSW 16 20685533 missense probably damaging 0.99
R5376:Eif4g1 UTSW 16 20683827 missense probably damaging 1.00
R5560:Eif4g1 UTSW 16 20686895 missense probably benign
R5719:Eif4g1 UTSW 16 20689011 missense probably damaging 1.00
R6632:Eif4g1 UTSW 16 20685520 missense probably damaging 0.99
R7134:Eif4g1 UTSW 16 20681502 missense probably damaging 1.00
R7793:Eif4g1 UTSW 16 20688614 missense probably benign 0.00
R7861:Eif4g1 UTSW 16 20679702 missense probably benign
R8309:Eif4g1 UTSW 16 20688828 missense probably benign 0.19
R8365:Eif4g1 UTSW 16 20683527 missense probably damaging 1.00
X0062:Eif4g1 UTSW 16 20684501 missense probably damaging 1.00
X0065:Eif4g1 UTSW 16 20682726 missense probably damaging 1.00
Z1176:Eif4g1 UTSW 16 20673408 intron probably benign
Z1177:Eif4g1 UTSW 16 20683905 missense probably benign 0.06
Z1177:Eif4g1 UTSW 16 20686366 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GACCCTAAGTAGAGTTGAGGAC -3'
(R):5'- TCTACCTCTGGTACTGCTGG -3'

Sequencing Primer
(F):5'- ACTTTGTAAACCAGGCTGGC -3'
(R):5'- GGGTCCACCTTCAATCATAGATG -3'
Posted On2018-09-12