Incidental Mutation 'R1697:Eif4g1'
ID192360
Institutional Source Beutler Lab
Gene Symbol Eif4g1
Ensembl Gene ENSMUSG00000045983
Gene Nameeukaryotic translation initiation factor 4, gamma 1
SynonymsE030015G23Rik
MMRRC Submission 039730-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R1697 (G1)
Quality Score204
Status Validated
Chromosome16
Chromosomal Location20668313-20692884 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20679780 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 422 (V422A)
Ref Sequence ENSEMBL: ENSMUSP00000116029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044783] [ENSMUST00000073840] [ENSMUST00000115457] [ENSMUST00000115460] [ENSMUST00000115461] [ENSMUST00000115463] [ENSMUST00000128594] [ENSMUST00000128840] [ENSMUST00000136713] [ENSMUST00000143939] [ENSMUST00000150333] [ENSMUST00000142344] [ENSMUST00000156226] [ENSMUST00000140576] [ENSMUST00000154950] [ENSMUST00000151679] [ENSMUST00000231618] [ENSMUST00000154594] [ENSMUST00000141034]
Predicted Effect probably damaging
Transcript: ENSMUST00000044783
AA Change: V429A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047678
Gene: ENSMUSG00000045983
AA Change: V429A

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073840
AA Change: V422A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073506
Gene: ENSMUSG00000045983
AA Change: V422A

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1028 1040 N/A INTRINSIC
low complexity region 1085 1099 N/A INTRINSIC
low complexity region 1150 1171 N/A INTRINSIC
low complexity region 1179 1194 N/A INTRINSIC
MA3 1235 1347 3.83e-39 SMART
low complexity region 1434 1445 N/A INTRINSIC
eIF5C 1501 1588 3.78e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104051
Predicted Effect possibly damaging
Transcript: ENSMUST00000115457
AA Change: V382A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111117
Gene: ENSMUSG00000045983
AA Change: V382A

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
PDB:1LJ2|D 132 159 9e-11 PDB
low complexity region 213 239 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
low complexity region 417 440 N/A INTRINSIC
Blast:MIF4G 591 636 7e-9 BLAST
low complexity region 638 660 N/A INTRINSIC
MIF4G 718 946 5.14e-72 SMART
low complexity region 988 1000 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1110 1131 N/A INTRINSIC
low complexity region 1139 1154 N/A INTRINSIC
MA3 1195 1307 3.83e-39 SMART
low complexity region 1394 1405 N/A INTRINSIC
eIF5C 1461 1548 3.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115460
AA Change: V429A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111120
Gene: ENSMUSG00000045983
AA Change: V429A

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:1LJ2|D 179 206 1e-10 PDB
low complexity region 260 286 N/A INTRINSIC
low complexity region 436 457 N/A INTRINSIC
low complexity region 464 487 N/A INTRINSIC
Blast:MIF4G 638 683 7e-9 BLAST
low complexity region 685 707 N/A INTRINSIC
MIF4G 765 993 5.14e-72 SMART
low complexity region 1035 1047 N/A INTRINSIC
low complexity region 1092 1106 N/A INTRINSIC
low complexity region 1157 1178 N/A INTRINSIC
low complexity region 1186 1201 N/A INTRINSIC
MA3 1242 1354 3.83e-39 SMART
low complexity region 1441 1452 N/A INTRINSIC
eIF5C 1508 1595 3.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115461
AA Change: V422A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111121
Gene: ENSMUSG00000045983
AA Change: V422A

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 8e-9 BLAST
low complexity region 678 693 N/A INTRINSIC
MIF4G 759 987 5.14e-72 SMART
low complexity region 1029 1041 N/A INTRINSIC
low complexity region 1086 1100 N/A INTRINSIC
low complexity region 1151 1172 N/A INTRINSIC
low complexity region 1180 1195 N/A INTRINSIC
MA3 1236 1348 3.83e-39 SMART
low complexity region 1435 1446 N/A INTRINSIC
eIF5C 1502 1589 3.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115463
AA Change: V422A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111123
Gene: ENSMUSG00000045983
AA Change: V422A

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 1e-10 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 676 7e-9 BLAST
low complexity region 678 700 N/A INTRINSIC
MIF4G 758 986 5.14e-72 SMART
low complexity region 1030 1036 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1143 1164 N/A INTRINSIC
low complexity region 1172 1187 N/A INTRINSIC
MA3 1228 1340 3.83e-39 SMART
low complexity region 1427 1438 N/A INTRINSIC
eIF5C 1494 1581 3.78e-33 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128594
AA Change: V258A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144594
Gene: ENSMUSG00000045983
AA Change: V258A

DomainStartEndE-ValueType
PDB:1LJ2|D 8 35 5e-11 PDB
low complexity region 89 115 N/A INTRINSIC
low complexity region 265 286 N/A INTRINSIC
low complexity region 293 316 N/A INTRINSIC
Blast:MIF4G 467 512 4e-9 BLAST
low complexity region 514 536 N/A INTRINSIC
MIF4G 594 795 1.1e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128840
SMART Domains Protein: ENSMUSP00000143861
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
PDB:1LJ2|D 85 112 5e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136106
Predicted Effect probably benign
Transcript: ENSMUST00000136713
SMART Domains Protein: ENSMUSP00000143999
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
PDB:1LJ2|D 85 112 3e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137690
Predicted Effect possibly damaging
Transcript: ENSMUST00000143939
AA Change: V132A

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144320
Gene: ENSMUSG00000045983
AA Change: V132A

DomainStartEndE-ValueType
low complexity region 139 160 N/A INTRINSIC
low complexity region 167 190 N/A INTRINSIC
Blast:MIF4G 341 386 6e-9 BLAST
low complexity region 388 410 N/A INTRINSIC
MIF4G 468 696 2.2e-74 SMART
low complexity region 738 750 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 860 881 N/A INTRINSIC
low complexity region 889 904 N/A INTRINSIC
MA3 945 1057 1.7e-41 SMART
low complexity region 1144 1155 N/A INTRINSIC
eIF5C 1211 1298 1.8e-35 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150333
AA Change: V363A

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144107
Gene: ENSMUSG00000045983
AA Change: V363A

DomainStartEndE-ValueType
PDB:1LJ2|D 113 140 5e-11 PDB
low complexity region 194 220 N/A INTRINSIC
low complexity region 370 391 N/A INTRINSIC
low complexity region 398 421 N/A INTRINSIC
Blast:MIF4G 572 613 9e-8 BLAST
low complexity region 619 641 N/A INTRINSIC
MIF4G 699 900 1.1e-52 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000142344
AA Change: V422A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116029
Gene: ENSMUSG00000045983
AA Change: V422A

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
PDB:1LJ2|D 172 199 5e-11 PDB
low complexity region 253 279 N/A INTRINSIC
low complexity region 429 450 N/A INTRINSIC
low complexity region 457 480 N/A INTRINSIC
Blast:MIF4G 631 672 6e-8 BLAST
low complexity region 678 693 N/A INTRINSIC
MIF4G 759 958 5.49e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156226
SMART Domains Protein: ENSMUSP00000119215
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 53 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231477
Predicted Effect probably benign
Transcript: ENSMUST00000140576
SMART Domains Protein: ENSMUSP00000117587
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 20 41 N/A INTRINSIC
PDB:1LJ2|D 129 156 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154950
SMART Domains Protein: ENSMUSP00000115230
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151679
SMART Domains Protein: ENSMUSP00000120698
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 13 34 N/A INTRINSIC
PDB:1LJ2|D 132 159 8e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000231618
Predicted Effect probably benign
Transcript: ENSMUST00000154594
SMART Domains Protein: ENSMUSP00000144233
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
PDB:1LJ2|D 8 35 3e-12 PDB
low complexity region 89 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141034
SMART Domains Protein: ENSMUSP00000120035
Gene: ENSMUSG00000045983

DomainStartEndE-ValueType
low complexity region 60 81 N/A INTRINSIC
PDB:4F02|F 175 200 4e-11 PDB
Meta Mutation Damage Score 0.0635 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene encodes a member of the eukaryotic translation initiation factors (eIF) that play important roles in translation initiation by mediating recruitment of additional initiation factors and providing a scaffold for ribosome/mRNA-bridging. Along with eIF4A and eIF4E, the encoded protein forms the eIF4F complex that bridges the 5' UTR with the polyadenylated 3' UTR resulting in mRNA circularization, enhanced translation initiation and mRNA stability. Through its association with eIF3, the encoded protein mediates recruitment of the 43S pre-initiation complex to mRNA. Alternative splicing of this gene results in multiple transcript variants. Pseudogenes for this gene have been identified on chromosomes 2 and 13. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for an amino acid substitution (R1207H) are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,845,114 D250E probably damaging Het
4930571K23Rik A G 7: 125,369,029 noncoding transcript Het
9530053A07Rik T A 7: 28,154,347 C1579S probably damaging Het
Acsl3 T C 1: 78,705,397 probably benign Het
Acsl6 C A 11: 54,329,966 T244K probably damaging Het
Adam26b T A 8: 43,520,963 N334I probably damaging Het
Adgrl4 C T 3: 151,517,611 T608M probably damaging Het
Aldh2 A G 5: 121,578,341 probably null Het
Alms1 A G 6: 85,622,454 T1890A possibly damaging Het
C87977 A C 4: 144,208,592 I193S probably damaging Het
Capn7 C T 14: 31,360,160 T441M probably damaging Het
Cd9 A T 6: 125,464,404 C85S probably damaging Het
Chrm3 T C 13: 9,878,758 T81A probably damaging Het
Ctif A G 18: 75,624,305 probably benign Het
Dcc T A 18: 71,370,737 D950V probably damaging Het
Enthd1 A G 15: 80,452,923 S437P probably damaging Het
Fads1 A G 19: 10,194,100 probably benign Het
Fat3 T A 9: 15,944,880 I3869L probably benign Het
Fbxw5 T A 2: 25,502,461 V85E possibly damaging Het
Fem1b T C 9: 62,797,174 D268G possibly damaging Het
Focad T C 4: 88,408,988 L1772P probably damaging Het
Gm9573 A C 17: 35,620,648 probably benign Het
Gm9833 G A 3: 10,089,553 V461I possibly damaging Het
Gtf3a C A 5: 146,951,913 Q145K possibly damaging Het
Hacl1 T C 14: 31,621,000 probably null Het
Herc2 T A 7: 56,153,905 F2229L probably benign Het
Hs3st4 A T 7: 124,396,857 I249L probably benign Het
Iqsec1 A T 6: 90,809,770 Y7* probably null Het
Klk1b1 T A 7: 43,970,326 M103K probably benign Het
Krt5 A G 15: 101,710,585 V287A probably benign Het
Lgals12 T A 19: 7,604,165 Q59L possibly damaging Het
Loxl4 A G 19: 42,604,940 V264A possibly damaging Het
Lrmp A G 6: 145,137,615 probably benign Het
Lrp1b T C 2: 40,822,683 D3099G probably damaging Het
Mical3 G A 6: 121,007,408 T169I possibly damaging Het
Myh7b A C 2: 155,620,134 S317R probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nsd1 A T 13: 55,214,059 probably null Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr152 T A 2: 87,782,585 I15N possibly damaging Het
Olfr190 A G 16: 59,074,907 Y58H probably damaging Het
Olfr331 A T 11: 58,501,676 S293R probably damaging Het
Olfr346 C T 2: 36,688,247 L82F probably damaging Het
Olfr769 T C 10: 129,111,868 T186A probably benign Het
Pcnx2 A G 8: 125,850,348 Y982H probably damaging Het
Pias3 T C 3: 96,702,225 L312P probably damaging Het
Plekhm1 G A 11: 103,376,884 P754S probably damaging Het
Ppp2r5c T A 12: 110,545,623 L145* probably null Het
Ppp2r5c T A 12: 110,561,472 probably benign Het
Proser3 T C 7: 30,540,021 M553V probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Smurf2 A T 11: 106,824,688 D664E possibly damaging Het
Spag9 G A 11: 93,996,565 A99T probably benign Het
Stim1 T G 7: 102,354,506 C49G probably damaging Het
Stk32c T C 7: 139,121,824 I238V probably benign Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tfb2m T A 1: 179,544,899 E133V probably null Het
Tmem209 A T 6: 30,497,868 C143S probably benign Het
Tnr T G 1: 159,852,030 N191K probably benign Het
Vars C T 17: 34,998,222 A419T probably benign Het
Vmn2r111 T C 17: 22,548,060 S819G probably benign Het
Wls T C 3: 159,897,358 V136A probably benign Het
Ybx2 C T 11: 69,940,061 S217L probably benign Het
Zfp82 T C 7: 30,057,354 D37G probably benign Het
Other mutations in Eif4g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Eif4g1 APN 16 20686754 intron probably benign
IGL00707:Eif4g1 APN 16 20689014 missense probably damaging 1.00
IGL00950:Eif4g1 APN 16 20683628 missense probably damaging 1.00
IGL01397:Eif4g1 APN 16 20679675 missense probably damaging 0.98
IGL01657:Eif4g1 APN 16 20682216 missense possibly damaging 0.94
IGL01875:Eif4g1 APN 16 20681040 missense probably damaging 0.96
IGL02728:Eif4g1 APN 16 20686752 intron probably benign
IGL03155:Eif4g1 APN 16 20692417 missense probably damaging 1.00
IGL03339:Eif4g1 APN 16 20680984 missense possibly damaging 0.72
R0032:Eif4g1 UTSW 16 20685898 missense probably damaging 1.00
R0032:Eif4g1 UTSW 16 20685898 missense probably damaging 1.00
R0138:Eif4g1 UTSW 16 20675345 missense probably damaging 0.99
R0556:Eif4g1 UTSW 16 20675794 missense probably damaging 0.99
R0576:Eif4g1 UTSW 16 20684068 missense probably damaging 0.98
R1424:Eif4g1 UTSW 16 20678942 missense probably benign 0.03
R1469:Eif4g1 UTSW 16 20680008 missense possibly damaging 0.86
R1469:Eif4g1 UTSW 16 20680008 missense possibly damaging 0.86
R1487:Eif4g1 UTSW 16 20678873 unclassified probably benign
R1659:Eif4g1 UTSW 16 20681061 missense probably damaging 0.99
R1848:Eif4g1 UTSW 16 20681867 missense probably damaging 1.00
R1855:Eif4g1 UTSW 16 20687161 missense possibly damaging 0.77
R1865:Eif4g1 UTSW 16 20678648 missense probably damaging 0.99
R3001:Eif4g1 UTSW 16 20692384 missense probably damaging 1.00
R3002:Eif4g1 UTSW 16 20692384 missense probably damaging 1.00
R4402:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4477:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4478:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4479:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4480:Eif4g1 UTSW 16 20678843 unclassified probably benign
R4623:Eif4g1 UTSW 16 20681345 unclassified probably benign
R4658:Eif4g1 UTSW 16 20685934 missense possibly damaging 0.78
R4751:Eif4g1 UTSW 16 20686515 missense possibly damaging 0.89
R4859:Eif4g1 UTSW 16 20682173 missense probably benign 0.44
R5267:Eif4g1 UTSW 16 20685533 missense probably damaging 0.99
R5376:Eif4g1 UTSW 16 20683827 missense probably damaging 1.00
R5560:Eif4g1 UTSW 16 20686895 missense probably benign
R5719:Eif4g1 UTSW 16 20689011 missense probably damaging 1.00
R6632:Eif4g1 UTSW 16 20685520 missense probably damaging 0.99
R6849:Eif4g1 UTSW 16 20680745 missense probably benign 0.08
R7134:Eif4g1 UTSW 16 20681502 missense probably damaging 1.00
R7793:Eif4g1 UTSW 16 20688614 missense probably benign 0.00
R7861:Eif4g1 UTSW 16 20679702 missense probably benign
R8309:Eif4g1 UTSW 16 20688828 missense probably benign 0.19
R8365:Eif4g1 UTSW 16 20683527 missense probably damaging 1.00
R8726:Eif4g1 UTSW 16 20675482 missense probably damaging 1.00
R8778:Eif4g1 UTSW 16 20673446 intron probably benign
X0062:Eif4g1 UTSW 16 20684501 missense probably damaging 1.00
X0065:Eif4g1 UTSW 16 20682726 missense probably damaging 1.00
Z1176:Eif4g1 UTSW 16 20673408 intron probably benign
Z1177:Eif4g1 UTSW 16 20683905 missense probably benign 0.06
Z1177:Eif4g1 UTSW 16 20686366 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGTGCCTCACAAGGTTGAAACTC -3'
(R):5'- AGCTGCTGCCACCTCTAAATTCTG -3'

Sequencing Primer
(F):5'- ATGAGCCCAATGGCGTG -3'
(R):5'- TGCCACCTCTAAATTCTGAGACAG -3'
Posted On2014-05-14