Mutagenetix > Incidental Mutation

Incidental Mutation 'R6806:Grin2b'

537478

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

044919-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6806 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135774828 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 579 (Y579H)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053880
AA Change: Y579H

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: Y579H

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111905
AA Change: Y579H

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: Y579H

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Meta Mutation Damage Score

0.6540

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

95% (39/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agbl1	A	G	7: 76,425,921 (GRCm38)	Y437C	probably damaging	Het
Apba2	T	A	7: 64,695,459 (GRCm38)	D132E	probably damaging	Het
Atp13a4	A	G	16: 29,469,280 (GRCm38)	S258P	probably damaging	Het
Bach2	T	A	4: 32,575,301 (GRCm38)	M509K	possibly damaging	Het
Ccdc186	T	A	19: 56,800,129 (GRCm38)	K549N	probably damaging	Het
Chrna3	C	T	9: 55,015,810 (GRCm38)	R238H	probably damaging	Het
Cntnap5b	G	A	1: 99,940,649 (GRCm38)	C30Y	probably damaging	Het
Cplane1	A	G	15: 8,186,858 (GRCm38)	Q520R	possibly damaging	Het
Dnah11	T	C	12: 117,987,676 (GRCm38)		probably null	Het
Ebna1bp2	T	C	4: 118,620,977 (GRCm38)	C16R	probably benign	Het
Ifi206	C	T	1: 173,481,571 (GRCm38)	M286I	probably benign	Het
Itpr1	G	A	6: 108,515,947 (GRCm38)	V2478I	probably benign	Het
Lrrc37	T	C	11: 103,621,124 (GRCm38)	E6G	unknown	Het
Ltbp2	T	C	12: 84,809,238 (GRCm38)	S744G	possibly damaging	Het
Magi3	T	A	3: 104,046,969 (GRCm38)	N684I	possibly damaging	Het
Muc16	A	G	9: 18,537,910 (GRCm38)		probably null	Het
Nphp4	G	T	4: 152,538,101 (GRCm38)	Q614H	probably benign	Het
Nprl3	A	G	11: 32,267,509 (GRCm38)	I11T	probably damaging	Het
Or51q1	G	T	7: 103,979,564 (GRCm38)	R124L	possibly damaging	Het
Pank2	T	C	2: 131,262,707 (GRCm38)		probably benign	Het
Prss58	A	T	6: 40,897,732 (GRCm38)	N58K	probably damaging	Het
Ptk7	C	T	17: 46,573,528 (GRCm38)	V759M	probably damaging	Het
Rassf7	A	G	7: 141,216,809 (GRCm38)	T28A	probably damaging	Het
Rbm45	C	T	2: 76,380,460 (GRCm38)	T445I	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904 (GRCm38)		probably benign	Het
Rsrc2	T	G	5: 123,739,531 (GRCm38)		probably benign	Het
Saxo2	A	T	7: 82,635,032 (GRCm38)	I206N	probably benign	Het
Sh3d19	T	A	3: 86,104,333 (GRCm38)	Y409N	probably damaging	Het
Spata31d1a	A	T	13: 59,703,218 (GRCm38)	N365K	probably benign	Het
Stkld1	C	G	2: 26,943,910 (GRCm38)	N136K	probably benign	Het
Tenm4	A	G	7: 96,811,959 (GRCm38)	D904G	possibly damaging	Het
Tmf1	G	A	6: 97,161,447 (GRCm38)	R837*	probably null	Het
Tnn	T	C	1: 160,120,708 (GRCm38)	T812A	possibly damaging	Het
Trgj4	T	C	13: 19,342,195 (GRCm38)	L15P	probably damaging	Het
Trp53bp1	T	C	2: 121,228,666 (GRCm38)	I905V	probably damaging	Het
Ubr3	T	C	2: 69,955,964 (GRCm38)		probably benign	Het
Zfp446	T	C	7: 12,979,116 (GRCm38)	L27P	probably damaging	Het
Zfp719	A	G	7: 43,586,385 (GRCm38)	D57G	possibly damaging	Het
Zfp747l1	T	C	7: 127,386,594 (GRCm38)		probably benign	Het
Zfp978	G	A	4: 147,390,827 (GRCm38)	R277K	probably benign	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135,736,331 (GRCm38)	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135,733,570 (GRCm38)	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135,736,363 (GRCm38)	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136,044,265 (GRCm38)	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135,733,381 (GRCm38)	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135,733,740 (GRCm38)	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135,732,586 (GRCm38)	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135,736,472 (GRCm38)	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135,739,090 (GRCm38)	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136,043,908 (GRCm38)	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135,923,391 (GRCm38)	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135,779,369 (GRCm38)	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135,922,998 (GRCm38)	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135,739,132 (GRCm38)	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135,739,115 (GRCm38)	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135,780,255 (GRCm38)	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135,923,203 (GRCm38)	missense	probably benign
R0055:Grin2b	UTSW	6	135,923,203 (GRCm38)	missense	probably benign
R0164:Grin2b	UTSW	6	135,778,648 (GRCm38)	splice site	probably benign
R0194:Grin2b	UTSW	6	135,779,305 (GRCm38)	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135,733,929 (GRCm38)	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135,843,195 (GRCm38)	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136,044,046 (GRCm38)	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135,732,732 (GRCm38)	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136,044,211 (GRCm38)	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135,733,245 (GRCm38)	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135,733,896 (GRCm38)	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135,780,140 (GRCm38)	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135,778,700 (GRCm38)	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135,733,182 (GRCm38)	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135,733,429 (GRCm38)	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135,740,953 (GRCm38)	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135,733,639 (GRCm38)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,733,639 (GRCm38)	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135,733,639 (GRCm38)	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135,732,455 (GRCm38)	small deletion	probably benign
R3418:Grin2b	UTSW	6	135,843,110 (GRCm38)	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135,923,271 (GRCm38)	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135,736,435 (GRCm38)	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135,778,741 (GRCm38)	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135,733,825 (GRCm38)	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135,774,872 (GRCm38)	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135,778,699 (GRCm38)	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135,733,407 (GRCm38)	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135,779,395 (GRCm38)	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135,732,441 (GRCm38)	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135,923,299 (GRCm38)	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135,779,342 (GRCm38)	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135,733,918 (GRCm38)	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136,044,283 (GRCm38)	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135,732,368 (GRCm38)	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135,736,306 (GRCm38)	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135,736,306 (GRCm38)	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135,736,306 (GRCm38)	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135,733,723 (GRCm38)	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135,923,397 (GRCm38)	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135,733,087 (GRCm38)	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135,740,964 (GRCm38)	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135,736,373 (GRCm38)	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135,733,944 (GRCm38)	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135,923,458 (GRCm38)	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135,772,399 (GRCm38)	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135,733,027 (GRCm38)	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135,780,279 (GRCm38)	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135,740,967 (GRCm38)	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135,733,344 (GRCm38)	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135,740,998 (GRCm38)	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135,732,551 (GRCm38)	missense	probably benign
R6647:Grin2b	UTSW	6	135,733,110 (GRCm38)	missense	probably damaging	1.00
R6976:Grin2b	UTSW	6	135,780,200 (GRCm38)	missense	probably benign
R7033:Grin2b	UTSW	6	135,923,038 (GRCm38)	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135,780,306 (GRCm38)	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135,733,476 (GRCm38)	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135,732,948 (GRCm38)	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135,780,251 (GRCm38)	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135,740,949 (GRCm38)	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135,772,396 (GRCm38)	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135,779,303 (GRCm38)	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135,923,364 (GRCm38)	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135,732,555 (GRCm38)	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135,778,794 (GRCm38)	nonsense	probably null
R8058:Grin2b	UTSW	6	135,733,227 (GRCm38)	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135,733,488 (GRCm38)	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135,732,499 (GRCm38)	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135,923,076 (GRCm38)	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135,732,199 (GRCm38)	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135,922,969 (GRCm38)	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135,733,916 (GRCm38)	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135,732,199 (GRCm38)	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135,922,987 (GRCm38)	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135,772,341 (GRCm38)	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135,772,341 (GRCm38)	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136,044,009 (GRCm38)	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135,732,511 (GRCm38)	frame shift	probably null
R9076:Grin2b	UTSW	6	135,732,511 (GRCm38)	frame shift	probably null
R9172:Grin2b	UTSW	6	135,779,257 (GRCm38)	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135,733,401 (GRCm38)	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135,922,870 (GRCm38)	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136,044,240 (GRCm38)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATAACATTGCTATGCTGACAACCAG -3'
(R):5'- AAGGGCACAGGACACACTTG -3'

Sequencing Primer
(F):5'- CATTGCTATGCTGACAACCAGAGATG -3'
(R):5'- GTGGCTTGCTCATCTTAAAATAGG -3'

Posted On

2018-10-18