Incidental Mutation 'R6806:Grin2b'
ID 537478
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Name glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission 044919-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6806 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 135713233-136173511 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 135774828 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 579 (Y579H)
Ref Sequence ENSEMBL: ENSMUSP00000107536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000053880
AA Change: Y579H

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: Y579H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111905
AA Change: Y579H

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: Y579H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Meta Mutation Damage Score 0.6540 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl1 A G 7: 76,425,921 (GRCm38) Y437C probably damaging Het
Apba2 T A 7: 64,695,459 (GRCm38) D132E probably damaging Het
Atp13a4 A G 16: 29,469,280 (GRCm38) S258P probably damaging Het
Bach2 T A 4: 32,575,301 (GRCm38) M509K possibly damaging Het
Ccdc186 T A 19: 56,800,129 (GRCm38) K549N probably damaging Het
Chrna3 C T 9: 55,015,810 (GRCm38) R238H probably damaging Het
Cntnap5b G A 1: 99,940,649 (GRCm38) C30Y probably damaging Het
Cplane1 A G 15: 8,186,858 (GRCm38) Q520R possibly damaging Het
Dnah11 T C 12: 117,987,676 (GRCm38) probably null Het
Ebna1bp2 T C 4: 118,620,977 (GRCm38) C16R probably benign Het
Ifi206 C T 1: 173,481,571 (GRCm38) M286I probably benign Het
Itpr1 G A 6: 108,515,947 (GRCm38) V2478I probably benign Het
Lrrc37 T C 11: 103,621,124 (GRCm38) E6G unknown Het
Ltbp2 T C 12: 84,809,238 (GRCm38) S744G possibly damaging Het
Magi3 T A 3: 104,046,969 (GRCm38) N684I possibly damaging Het
Muc16 A G 9: 18,537,910 (GRCm38) probably null Het
Nphp4 G T 4: 152,538,101 (GRCm38) Q614H probably benign Het
Nprl3 A G 11: 32,267,509 (GRCm38) I11T probably damaging Het
Or51q1 G T 7: 103,979,564 (GRCm38) R124L possibly damaging Het
Pank2 T C 2: 131,262,707 (GRCm38) probably benign Het
Prss58 A T 6: 40,897,732 (GRCm38) N58K probably damaging Het
Ptk7 C T 17: 46,573,528 (GRCm38) V759M probably damaging Het
Rassf7 A G 7: 141,216,809 (GRCm38) T28A probably damaging Het
Rbm45 C T 2: 76,380,460 (GRCm38) T445I probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 (GRCm38) probably benign Het
Rsrc2 T G 5: 123,739,531 (GRCm38) probably benign Het
Saxo2 A T 7: 82,635,032 (GRCm38) I206N probably benign Het
Sh3d19 T A 3: 86,104,333 (GRCm38) Y409N probably damaging Het
Spata31d1a A T 13: 59,703,218 (GRCm38) N365K probably benign Het
Stkld1 C G 2: 26,943,910 (GRCm38) N136K probably benign Het
Tenm4 A G 7: 96,811,959 (GRCm38) D904G possibly damaging Het
Tmf1 G A 6: 97,161,447 (GRCm38) R837* probably null Het
Tnn T C 1: 160,120,708 (GRCm38) T812A possibly damaging Het
Trgj4 T C 13: 19,342,195 (GRCm38) L15P probably damaging Het
Trp53bp1 T C 2: 121,228,666 (GRCm38) I905V probably damaging Het
Ubr3 T C 2: 69,955,964 (GRCm38) probably benign Het
Zfp446 T C 7: 12,979,116 (GRCm38) L27P probably damaging Het
Zfp719 A G 7: 43,586,385 (GRCm38) D57G possibly damaging Het
Zfp747l1 T C 7: 127,386,594 (GRCm38) probably benign Het
Zfp978 G A 4: 147,390,827 (GRCm38) R277K probably benign Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135,736,331 (GRCm38) missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135,733,570 (GRCm38) missense probably damaging 1.00
IGL01401:Grin2b APN 6 135,736,363 (GRCm38) missense probably damaging 1.00
IGL01523:Grin2b APN 6 136,044,265 (GRCm38) missense probably null 0.99
IGL01719:Grin2b APN 6 135,733,381 (GRCm38) missense probably damaging 0.97
IGL01907:Grin2b APN 6 135,733,740 (GRCm38) missense probably damaging 1.00
IGL01996:Grin2b APN 6 135,732,586 (GRCm38) missense probably damaging 1.00
IGL02309:Grin2b APN 6 135,736,472 (GRCm38) missense probably damaging 1.00
IGL02312:Grin2b APN 6 135,739,090 (GRCm38) missense probably damaging 1.00
IGL02409:Grin2b APN 6 136,043,908 (GRCm38) missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135,923,391 (GRCm38) missense probably damaging 1.00
IGL02535:Grin2b APN 6 135,779,369 (GRCm38) missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135,922,998 (GRCm38) missense probably damaging 1.00
IGL02702:Grin2b APN 6 135,739,132 (GRCm38) missense probably damaging 0.99
IGL03001:Grin2b APN 6 135,739,115 (GRCm38) missense probably damaging 1.00
IGL03274:Grin2b APN 6 135,780,255 (GRCm38) missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135,923,203 (GRCm38) missense probably benign
R0055:Grin2b UTSW 6 135,923,203 (GRCm38) missense probably benign
R0164:Grin2b UTSW 6 135,778,648 (GRCm38) splice site probably benign
R0194:Grin2b UTSW 6 135,779,305 (GRCm38) missense probably damaging 1.00
R0594:Grin2b UTSW 6 135,733,929 (GRCm38) missense probably damaging 1.00
R1434:Grin2b UTSW 6 135,843,195 (GRCm38) missense probably benign 0.04
R1928:Grin2b UTSW 6 136,044,046 (GRCm38) missense probably damaging 1.00
R1942:Grin2b UTSW 6 135,732,732 (GRCm38) missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136,044,211 (GRCm38) missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135,733,245 (GRCm38) missense probably damaging 1.00
R2020:Grin2b UTSW 6 135,733,896 (GRCm38) missense probably benign 0.12
R2103:Grin2b UTSW 6 135,780,140 (GRCm38) missense probably benign 0.02
R2127:Grin2b UTSW 6 135,778,700 (GRCm38) missense probably benign 0.03
R2495:Grin2b UTSW 6 135,733,182 (GRCm38) missense probably damaging 1.00
R2656:Grin2b UTSW 6 135,733,429 (GRCm38) missense probably damaging 1.00
R2847:Grin2b UTSW 6 135,740,953 (GRCm38) missense probably damaging 1.00
R2866:Grin2b UTSW 6 135,733,639 (GRCm38) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,733,639 (GRCm38) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,733,639 (GRCm38) missense probably damaging 1.00
R3196:Grin2b UTSW 6 135,732,455 (GRCm38) small deletion probably benign
R3418:Grin2b UTSW 6 135,843,110 (GRCm38) missense probably benign 0.02
R3808:Grin2b UTSW 6 135,923,271 (GRCm38) missense probably damaging 0.99
R4028:Grin2b UTSW 6 135,736,435 (GRCm38) missense probably damaging 1.00
R4602:Grin2b UTSW 6 135,778,741 (GRCm38) missense probably damaging 1.00
R4624:Grin2b UTSW 6 135,733,825 (GRCm38) missense probably damaging 0.99
R4677:Grin2b UTSW 6 135,774,872 (GRCm38) missense probably benign 0.13
R4744:Grin2b UTSW 6 135,778,699 (GRCm38) missense probably damaging 1.00
R5020:Grin2b UTSW 6 135,733,407 (GRCm38) missense probably benign 0.01
R5051:Grin2b UTSW 6 135,779,395 (GRCm38) missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135,732,441 (GRCm38) missense probably benign 0.03
R5125:Grin2b UTSW 6 135,923,299 (GRCm38) missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135,779,342 (GRCm38) missense probably damaging 1.00
R5318:Grin2b UTSW 6 135,733,918 (GRCm38) missense probably damaging 0.99
R5349:Grin2b UTSW 6 136,044,283 (GRCm38) missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135,732,368 (GRCm38) missense probably damaging 1.00
R5438:Grin2b UTSW 6 135,736,306 (GRCm38) missense probably damaging 1.00
R5439:Grin2b UTSW 6 135,736,306 (GRCm38) missense probably damaging 1.00
R5440:Grin2b UTSW 6 135,736,306 (GRCm38) missense probably damaging 1.00
R5530:Grin2b UTSW 6 135,733,723 (GRCm38) missense probably benign 0.00
R5603:Grin2b UTSW 6 135,923,397 (GRCm38) missense probably damaging 1.00
R5657:Grin2b UTSW 6 135,733,087 (GRCm38) missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135,740,964 (GRCm38) missense probably benign 0.24
R5941:Grin2b UTSW 6 135,736,373 (GRCm38) missense probably damaging 0.99
R6057:Grin2b UTSW 6 135,733,944 (GRCm38) missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135,923,458 (GRCm38) missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135,772,399 (GRCm38) missense probably damaging 1.00
R6309:Grin2b UTSW 6 135,733,027 (GRCm38) missense probably benign 0.00
R6316:Grin2b UTSW 6 135,780,279 (GRCm38) missense probably benign 0.00
R6419:Grin2b UTSW 6 135,740,967 (GRCm38) missense probably damaging 1.00
R6551:Grin2b UTSW 6 135,733,344 (GRCm38) missense probably damaging 1.00
R6612:Grin2b UTSW 6 135,740,998 (GRCm38) missense probably damaging 1.00
R6616:Grin2b UTSW 6 135,732,551 (GRCm38) missense probably benign
R6647:Grin2b UTSW 6 135,733,110 (GRCm38) missense probably damaging 1.00
R6976:Grin2b UTSW 6 135,780,200 (GRCm38) missense probably benign
R7033:Grin2b UTSW 6 135,923,038 (GRCm38) missense probably damaging 1.00
R7058:Grin2b UTSW 6 135,780,306 (GRCm38) missense probably damaging 0.97
R7144:Grin2b UTSW 6 135,733,476 (GRCm38) missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135,732,948 (GRCm38) missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135,780,251 (GRCm38) missense probably damaging 0.97
R7453:Grin2b UTSW 6 135,740,949 (GRCm38) missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135,772,396 (GRCm38) missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135,779,303 (GRCm38) missense probably damaging 0.99
R7615:Grin2b UTSW 6 135,923,364 (GRCm38) missense probably damaging 1.00
R7632:Grin2b UTSW 6 135,732,555 (GRCm38) missense probably benign 0.02
R7779:Grin2b UTSW 6 135,778,794 (GRCm38) nonsense probably null
R8058:Grin2b UTSW 6 135,733,227 (GRCm38) missense probably damaging 1.00
R8084:Grin2b UTSW 6 135,733,488 (GRCm38) missense probably benign 0.03
R8145:Grin2b UTSW 6 135,732,499 (GRCm38) missense probably benign 0.01
R8308:Grin2b UTSW 6 135,923,076 (GRCm38) missense probably damaging 0.99
R8357:Grin2b UTSW 6 135,732,199 (GRCm38) missense probably benign 0.00
R8379:Grin2b UTSW 6 135,922,969 (GRCm38) missense probably damaging 1.00
R8429:Grin2b UTSW 6 135,733,916 (GRCm38) missense probably damaging 1.00
R8457:Grin2b UTSW 6 135,732,199 (GRCm38) missense probably benign 0.00
R8746:Grin2b UTSW 6 135,922,987 (GRCm38) missense probably benign 0.02
R8925:Grin2b UTSW 6 135,772,341 (GRCm38) missense probably damaging 0.97
R8927:Grin2b UTSW 6 135,772,341 (GRCm38) missense probably damaging 0.97
R8963:Grin2b UTSW 6 136,044,009 (GRCm38) missense probably damaging 1.00
R9075:Grin2b UTSW 6 135,732,511 (GRCm38) frame shift probably null
R9076:Grin2b UTSW 6 135,732,511 (GRCm38) frame shift probably null
R9172:Grin2b UTSW 6 135,779,257 (GRCm38) missense possibly damaging 0.84
R9520:Grin2b UTSW 6 135,733,401 (GRCm38) missense probably damaging 1.00
R9740:Grin2b UTSW 6 135,922,870 (GRCm38) critical splice donor site probably null
RF001:Grin2b UTSW 6 136,044,240 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAACATTGCTATGCTGACAACCAG -3'
(R):5'- AAGGGCACAGGACACACTTG -3'

Sequencing Primer
(F):5'- CATTGCTATGCTGACAACCAGAGATG -3'
(R):5'- GTGGCTTGCTCATCTTAAAATAGG -3'
Posted On 2018-10-18