Incidental Mutation 'R6806:Grin2b'
ID537478
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6806 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135774828 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 579 (Y579H)
Ref Sequence ENSEMBL: ENSMUSP00000107536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053880
AA Change: Y579H

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: Y579H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111905
AA Change: Y579H

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: Y579H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Meta Mutation Damage Score 0.6540 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,858 Q520R possibly damaging Het
9130019O22Rik T C 7: 127,386,594 probably benign Het
Agbl1 A G 7: 76,425,921 Y437C probably damaging Het
Apba2 T A 7: 64,695,459 D132E probably damaging Het
Atp13a4 A G 16: 29,469,280 S258P probably damaging Het
Bach2 T A 4: 32,575,301 M509K possibly damaging Het
Ccdc186 T A 19: 56,800,129 K549N probably damaging Het
Chrna3 C T 9: 55,015,810 R238H probably damaging Het
Cntnap5b G A 1: 99,940,649 C30Y probably damaging Het
Dnah11 T C 12: 117,987,676 probably null Het
Ebna1bp2 T C 4: 118,620,977 C16R probably benign Het
Gm884 T C 11: 103,621,124 E6G unknown Het
Ifi206 C T 1: 173,481,571 M286I probably benign Het
Itpr1 G A 6: 108,515,947 V2478I probably benign Het
Ltbp2 T C 12: 84,809,238 S744G possibly damaging Het
Magi3 T A 3: 104,046,969 N684I possibly damaging Het
Muc16 A G 9: 18,537,910 probably null Het
Nphp4 G T 4: 152,538,101 Q614H probably benign Het
Nprl3 A G 11: 32,267,509 I11T probably damaging Het
Olfr635 G T 7: 103,979,564 R124L possibly damaging Het
Pank2 T C 2: 131,262,707 probably benign Het
Prss58 A T 6: 40,897,732 N58K probably damaging Het
Ptk7 C T 17: 46,573,528 V759M probably damaging Het
Rassf7 A G 7: 141,216,809 T28A probably damaging Het
Rbm45 C T 2: 76,380,460 T445I probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc2 T G 5: 123,739,531 probably benign Het
Saxo2 A T 7: 82,635,032 I206N probably benign Het
Sh3d19 T A 3: 86,104,333 Y409N probably damaging Het
Spata31d1a A T 13: 59,703,218 N365K probably benign Het
Stkld1 C G 2: 26,943,910 N136K probably benign Het
Tenm4 A G 7: 96,811,959 D904G possibly damaging Het
Tmf1 G A 6: 97,161,447 R837* probably null Het
Tnn T C 1: 160,120,708 T812A possibly damaging Het
Trgj4 T C 13: 19,342,195 L15P probably damaging Het
Trp53bp1 T C 2: 121,228,666 I905V probably damaging Het
Ubr3 T C 2: 69,955,964 probably benign Het
Zfp446 T C 7: 12,979,116 L27P probably damaging Het
Zfp719 A G 7: 43,586,385 D57G possibly damaging Het
Zfp978 G A 4: 147,390,827 R277K probably benign Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
R8357:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8379:Grin2b UTSW 6 135922969 missense probably damaging 1.00
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAACATTGCTATGCTGACAACCAG -3'
(R):5'- AAGGGCACAGGACACACTTG -3'

Sequencing Primer
(F):5'- CATTGCTATGCTGACAACCAGAGATG -3'
(R):5'- GTGGCTTGCTCATCTTAAAATAGG -3'
Posted On2018-10-18