Incidental Mutation 'R6806:Agbl1'
ID 537483
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene Name ATP/GTP binding protein-like 1
Synonyms Nna1-l1, EG244071
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6806 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 76229887-77124698 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 76425921 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 437 (Y437C)
Ref Sequence ENSEMBL: ENSMUSP00000103066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026854] [ENSMUST00000107442] [ENSMUST00000156166]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026854
AA Change: Y437C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026854
Gene: ENSMUSG00000025754
AA Change: Y437C

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 493 631 4.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107442
AA Change: Y437C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: Y437C

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 494 754 3.1e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156166
AA Change: Y689C
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: Y689C

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,858 Q520R possibly damaging Het
9130019O22Rik T C 7: 127,386,594 probably benign Het
Apba2 T A 7: 64,695,459 D132E probably damaging Het
Atp13a4 A G 16: 29,469,280 S258P probably damaging Het
Bach2 T A 4: 32,575,301 M509K possibly damaging Het
Ccdc186 T A 19: 56,800,129 K549N probably damaging Het
Chrna3 C T 9: 55,015,810 R238H probably damaging Het
Cntnap5b G A 1: 99,940,649 C30Y probably damaging Het
Dnah11 T C 12: 117,987,676 probably null Het
Ebna1bp2 T C 4: 118,620,977 C16R probably benign Het
Gm884 T C 11: 103,621,124 E6G unknown Het
Grin2b A G 6: 135,774,828 Y579H possibly damaging Het
Ifi206 C T 1: 173,481,571 M286I probably benign Het
Itpr1 G A 6: 108,515,947 V2478I probably benign Het
Ltbp2 T C 12: 84,809,238 S744G possibly damaging Het
Magi3 T A 3: 104,046,969 N684I possibly damaging Het
Muc16 A G 9: 18,537,910 probably null Het
Nphp4 G T 4: 152,538,101 Q614H probably benign Het
Nprl3 A G 11: 32,267,509 I11T probably damaging Het
Olfr635 G T 7: 103,979,564 R124L possibly damaging Het
Pank2 T C 2: 131,262,707 probably benign Het
Prss58 A T 6: 40,897,732 N58K probably damaging Het
Ptk7 C T 17: 46,573,528 V759M probably damaging Het
Rassf7 A G 7: 141,216,809 T28A probably damaging Het
Rbm45 C T 2: 76,380,460 T445I probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc2 T G 5: 123,739,531 probably benign Het
Saxo2 A T 7: 82,635,032 I206N probably benign Het
Sh3d19 T A 3: 86,104,333 Y409N probably damaging Het
Spata31d1a A T 13: 59,703,218 N365K probably benign Het
Stkld1 C G 2: 26,943,910 N136K probably benign Het
Tenm4 A G 7: 96,811,959 D904G possibly damaging Het
Tmf1 G A 6: 97,161,447 R837* probably null Het
Tnn T C 1: 160,120,708 T812A possibly damaging Het
Trgj4 T C 13: 19,342,195 L15P probably damaging Het
Trp53bp1 T C 2: 121,228,666 I905V probably damaging Het
Ubr3 T C 2: 69,955,964 probably benign Het
Zfp446 T C 7: 12,979,116 L27P probably damaging Het
Zfp719 A G 7: 43,586,385 D57G possibly damaging Het
Zfp978 G A 4: 147,390,827 R277K probably benign Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76421880 missense probably benign 0.01
IGL01650:Agbl1 APN 7 76420319 missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76766372 missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76720142 missense probably benign 0.12
IGL03143:Agbl1 APN 7 76420045 nonsense probably null
IGL03306:Agbl1 APN 7 76589504 missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76419863 missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0045:Agbl1 UTSW 7 76698840 critical splice donor site probably null
R0541:Agbl1 UTSW 7 76409245 missense probably benign 0.22
R1889:Agbl1 UTSW 7 76589381 missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76589500 missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76419880 missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76414717 splice site probably null
R2229:Agbl1 UTSW 7 76433378 missense probably benign 0.43
R2243:Agbl1 UTSW 7 76418722 missense possibly damaging 0.93
R2255:Agbl1 UTSW 7 76422184 missense probably damaging 1.00
R2411:Agbl1 UTSW 7 76720150 missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76421902 missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76589550 critical splice donor site probably null
R2910:Agbl1 UTSW 7 76419838 missense probably benign 0.13
R2919:Agbl1 UTSW 7 76414658 missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76766484 missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76720196 missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R3825:Agbl1 UTSW 7 76419967 missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76413685 missense probably benign 0.00
R4857:Agbl1 UTSW 7 76419835 missense probably benign 0.03
R4943:Agbl1 UTSW 7 76420016 missense probably benign 0.01
R5055:Agbl1 UTSW 7 76413577 missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76421917 missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76720133 missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76422156 missense probably benign 0.21
R5576:Agbl1 UTSW 7 76335237 missense probably benign 0.03
R5665:Agbl1 UTSW 7 76589503 missense probably damaging 1.00
R5849:Agbl1 UTSW 7 76325098 missense probably benign 0.35
R5924:Agbl1 UTSW 7 76409234 missense probably benign 0.12
R6044:Agbl1 UTSW 7 76318120 missense possibly damaging 0.56
R6117:Agbl1 UTSW 7 76698786 missense probably damaging 1.00
R6144:Agbl1 UTSW 7 76420084 missense probably benign 0.02
R6368:Agbl1 UTSW 7 76419830 missense probably benign 0.25
R7455:Agbl1 UTSW 7 76424755 missense unknown
R7459:Agbl1 UTSW 7 76420066 missense not run
R7485:Agbl1 UTSW 7 76589493 missense unknown
R7516:Agbl1 UTSW 7 76425921 missense probably damaging 1.00
R7539:Agbl1 UTSW 7 76425929 critical splice donor site probably null
R7561:Agbl1 UTSW 7 76698761 missense unknown
R7630:Agbl1 UTSW 7 76886156 missense unknown
R7655:Agbl1 UTSW 7 76409332 missense
R7656:Agbl1 UTSW 7 76409332 missense
R7658:Agbl1 UTSW 7 76766369 missense unknown
R7681:Agbl1 UTSW 7 76444901 missense unknown
R7694:Agbl1 UTSW 7 76698765 missense unknown
R7773:Agbl1 UTSW 7 76698837 missense unknown
R7981:Agbl1 UTSW 7 76444840 missense unknown
R8208:Agbl1 UTSW 7 76720168 missense unknown
R8317:Agbl1 UTSW 7 76422181 missense unknown
R8406:Agbl1 UTSW 7 76418667 missense
R8432:Agbl1 UTSW 7 77124686 missense unknown
R8704:Agbl1 UTSW 7 76589554 splice site probably benign
R8830:Agbl1 UTSW 7 76335311 missense
R8985:Agbl1 UTSW 7 76320156 missense
R9113:Agbl1 UTSW 7 76589477 missense unknown
R9170:Agbl1 UTSW 7 76335321 missense
R9229:Agbl1 UTSW 7 77124522 missense unknown
R9255:Agbl1 UTSW 7 76766402 missense unknown
R9391:Agbl1 UTSW 7 76421854 missense unknown
R9646:Agbl1 UTSW 7 76425900 missense unknown
Z1088:Agbl1 UTSW 7 76419904 missense probably benign 0.00
Z1176:Agbl1 UTSW 7 76418685 missense
Z1177:Agbl1 UTSW 7 76720206 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAAAATGTGAGCCTTAACTCTTGC -3'
(R):5'- GTCAGGGGACTAATGCAAGTTC -3'

Sequencing Primer
(F):5'- CCTCATAAGGGCATCAGTGGTTAC -3'
(R):5'- GCAAACAAACAGGTTGTGG -3'
Posted On 2018-10-18