Incidental Mutation 'R6916:Pcdhb11'
ID539379
Institutional Source Beutler Lab
Gene Symbol Pcdhb11
Ensembl Gene ENSMUSG00000051486
Gene Nameprotocadherin beta 11
SynonymsPcdhb5E, PcdhbK
MMRRC Submission
Accession Numbers

Genbank: NM_053136.3; Ensembl: ENSMUST00000053073

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6916 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37421418-37425836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37422381 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 255 (S255C)
Ref Sequence ENSEMBL: ENSMUSP00000056148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053073] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053073
AA Change: S255C

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056148
Gene: ENSMUSG00000051486
AA Change: S255C

DomainStartEndE-ValueType
CA 54 131 3.51e-1 SMART
CA 155 240 4.11e-21 SMART
CA 264 344 6.37e-27 SMART
CA 367 448 4.79e-22 SMART
CA 472 558 7.31e-27 SMART
CA 588 669 2.46e-10 SMART
Pfam:Cadherin_C_2 686 769 3.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.1452 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T A 6: 48,931,053 I329N probably benign Het
2700049A03Rik T A 12: 71,164,544 I684K possibly damaging Het
Abcg3 T A 5: 104,974,735 R97S probably benign Het
Acin1 A T 14: 54,665,416 F160L probably benign Het
Asb10 T C 5: 24,537,856 D293G probably damaging Het
Atp6v1c1 T C 15: 38,677,581 S117P probably benign Het
Bahcc1 T A 11: 120,273,009 V711E probably damaging Het
Baz2b A T 2: 59,968,776 S335T probably benign Het
Bdkrb2 C T 12: 105,591,779 A93V probably damaging Het
Cacna1d A T 14: 30,095,364 V1247D probably damaging Het
Cenpb A C 2: 131,179,624 F85V probably benign Het
Cep112 C A 11: 108,859,376 Q142K probably damaging Het
Ciita T A 16: 10,509,207 probably null Het
Cnr1 A G 4: 33,943,897 D95G probably benign Het
Ctnnd1 A T 2: 84,609,646 D767E probably benign Het
Ddx20 T C 3: 105,680,613 N384D probably damaging Het
Dnaaf3 T A 7: 4,527,533 D191V probably damaging Het
Efna1 T C 3: 89,276,388 N44D possibly damaging Het
Errfi1 A T 4: 150,867,473 K453* probably null Het
Fam149a C A 8: 45,350,406 K349N probably damaging Het
Fbxl20 T A 11: 98,113,253 I70L possibly damaging Het
Flnb C T 14: 7,907,171 T1248I probably damaging Het
Frem2 T C 3: 53,547,688 R2156G probably damaging Het
Ftl1 T C 7: 45,459,540 Y31C probably damaging Het
Gm5862 G T 5: 26,019,348 H208N probably benign Het
Hc A T 2: 35,010,032 Y1096* probably null Het
Hps1 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 19: 42,766,725 Het
Ints3 T C 3: 90,406,334 D329G probably damaging Het
Irak3 A T 10: 120,201,365 L32Q probably damaging Het
Kif1bp T C 10: 62,566,064 T20A probably benign Het
Klrb1f A T 6: 129,053,811 D95V probably benign Het
Krt79 C T 15: 101,936,170 D260N probably benign Het
Lrp11 C A 10: 7,608,714 probably null Het
Lrrc10 C A 10: 117,045,549 R43S possibly damaging Het
Muc5b A T 7: 141,864,717 Y3800F possibly damaging Het
Myh14 T C 7: 44,629,313 K1003E probably damaging Het
Nbeal2 A G 9: 110,626,108 I2567T probably damaging Het
Necab2 G T 8: 119,467,616 R277L probably damaging Het
Nell1 T C 7: 50,701,179 Y525H probably benign Het
Olfm4 T A 14: 80,014,198 M186K probably damaging Het
Olfr389 T A 11: 73,777,069 Q86L probably benign Het
Olfr753-ps1 T C 17: 37,169,973 K225R probably benign Het
Olfr934 T C 9: 38,982,904 I47V probably benign Het
Rrbp1 A T 2: 143,974,598 C704S probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sh2d3c C T 2: 32,752,653 R552* probably null Het
Sh3d19 A G 3: 86,084,911 E82G probably benign Het
Son T A 16: 91,654,785 L140Q probably damaging Het
Svil G A 18: 5,114,682 probably benign Het
Syne1 T C 10: 5,227,912 K4854R probably benign Het
Tmem202 C A 9: 59,525,474 probably benign Het
Tmem56 T C 3: 121,207,156 D276G possibly damaging Het
Trak2 T C 1: 58,910,025 T539A probably benign Het
Trdn T C 10: 33,157,018 S80P probably damaging Het
Ugt2b37 T A 5: 87,254,600 R57S probably benign Het
Usp34 G A 11: 23,458,023 R2616Q probably damaging Het
Usp48 T C 4: 137,638,233 Y113H probably damaging Het
Vtcn1 G T 3: 100,888,163 probably null Het
Wdr19 G A 5: 65,225,334 R467Q possibly damaging Het
Wdr72 A G 9: 74,155,039 Y489C probably benign Het
Wipf1 C A 2: 73,437,404 G217W probably damaging Het
Other mutations in Pcdhb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Pcdhb11 APN 18 37421973 missense probably benign 0.00
IGL00906:Pcdhb11 APN 18 37422121 missense possibly damaging 0.67
IGL01610:Pcdhb11 APN 18 37423359 missense probably benign 0.00
IGL01973:Pcdhb11 APN 18 37423512 missense probably damaging 1.00
IGL01977:Pcdhb11 APN 18 37422291 missense possibly damaging 0.49
IGL02164:Pcdhb11 APN 18 37423359 missense probably benign 0.00
IGL02282:Pcdhb11 APN 18 37423828 missense probably damaging 1.00
IGL02674:Pcdhb11 APN 18 37423614 missense probably damaging 1.00
IGL02965:Pcdhb11 APN 18 37423968 missense probably benign
IGL03197:Pcdhb11 APN 18 37422424 nonsense probably null
1mM(1):Pcdhb11 UTSW 18 37423957 missense probably benign 0.00
R0001:Pcdhb11 UTSW 18 37423989 missense probably benign 0.06
R0383:Pcdhb11 UTSW 18 37423393 missense probably damaging 1.00
R0421:Pcdhb11 UTSW 18 37422480 missense probably benign 0.04
R0422:Pcdhb11 UTSW 18 37421870 missense probably damaging 1.00
R0427:Pcdhb11 UTSW 18 37422765 missense probably damaging 1.00
R0542:Pcdhb11 UTSW 18 37423834 missense probably damaging 1.00
R0620:Pcdhb11 UTSW 18 37421811 nonsense probably null
R1014:Pcdhb11 UTSW 18 37423369 missense probably damaging 1.00
R1277:Pcdhb11 UTSW 18 37421716 missense possibly damaging 0.79
R2034:Pcdhb11 UTSW 18 37422493 missense probably benign 0.00
R2142:Pcdhb11 UTSW 18 37422123 missense probably benign 0.28
R2496:Pcdhb11 UTSW 18 37422322 missense probably benign 0.30
R3077:Pcdhb11 UTSW 18 37422244 missense probably benign 0.08
R4560:Pcdhb11 UTSW 18 37423734 missense possibly damaging 0.61
R4590:Pcdhb11 UTSW 18 37422496 missense probably damaging 0.98
R4642:Pcdhb11 UTSW 18 37421968 missense probably benign 0.01
R4729:Pcdhb11 UTSW 18 37422366 nonsense probably null
R5012:Pcdhb11 UTSW 18 37422976 missense possibly damaging 0.48
R5364:Pcdhb11 UTSW 18 37422179 missense probably benign 0.06
R5910:Pcdhb11 UTSW 18 37423743 missense probably benign 0.43
R6023:Pcdhb11 UTSW 18 37422925 missense possibly damaging 0.94
R6106:Pcdhb11 UTSW 18 37423003 missense probably damaging 1.00
R6254:Pcdhb11 UTSW 18 37421718 missense probably damaging 0.99
R6276:Pcdhb11 UTSW 18 37421760 missense probably benign 0.36
R6360:Pcdhb11 UTSW 18 37422159 missense probably benign
R6699:Pcdhb11 UTSW 18 37422937 missense probably damaging 1.00
R6732:Pcdhb11 UTSW 18 37422144 missense probably benign
R6760:Pcdhb11 UTSW 18 37421584 intron probably benign
R7130:Pcdhb11 UTSW 18 37423506 missense probably benign 0.04
R7267:Pcdhb11 UTSW 18 37421953 missense possibly damaging 0.61
R7426:Pcdhb11 UTSW 18 37423260 missense probably damaging 0.99
R7444:Pcdhb11 UTSW 18 37422619 missense probably damaging 0.98
R7492:Pcdhb11 UTSW 18 37423444 missense probably damaging 1.00
R7504:Pcdhb11 UTSW 18 37421799 missense probably benign
R7537:Pcdhb11 UTSW 18 37421619 start codon destroyed possibly damaging 0.88
R7728:Pcdhb11 UTSW 18 37423477 missense probably damaging 1.00
R7817:Pcdhb11 UTSW 18 37423909 missense probably damaging 1.00
R8071:Pcdhb11 UTSW 18 37422369 missense probably benign 0.02
R8229:Pcdhb11 UTSW 18 37422618 missense probably benign 0.00
R8254:Pcdhb11 UTSW 18 37422189 missense probably benign 0.45
R8356:Pcdhb11 UTSW 18 37422199 missense probably damaging 1.00
R8739:Pcdhb11 UTSW 18 37422496 missense probably damaging 1.00
R8957:Pcdhb11 UTSW 18 37421639 missense probably benign 0.43
R8957:Pcdhb11 UTSW 18 37422819 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCACGTCATTACTCACAGTCG -3'
(R):5'- GCTAATTCCCTCGAAATCCAGC -3'

Sequencing Primer
(F):5'- ATTACTCACAGTCGCTCAGATGG -3'
(R):5'- GCTCTTTGCTAAGACGGATTTC -3'
Posted On2018-11-06