Incidental Mutation 'R6932:Cgrrf1'
ID540126
Institutional Source Beutler Lab
Gene Symbol Cgrrf1
Ensembl Gene ENSMUSG00000055128
Gene Namecell growth regulator with ring finger domain 1
Synonyms1810009H17Rik, CGR19, 1110038G02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6932 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location46832125-46854193 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46853722 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 234 (N234K)
Ref Sequence ENSEMBL: ENSMUSP00000070548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068532] [ENSMUST00000226861]
Predicted Effect probably benign
Transcript: ENSMUST00000068532
AA Change: N234K

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000070548
Gene: ENSMUSG00000055128
AA Change: N234K

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 233 246 N/A INTRINSIC
RING 274 308 2.26e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226861
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 98% (80/82)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik CA CAA 8: 13,734,865 probably null Het
Acads A T 5: 115,112,272 F198I probably damaging Het
Acy1 A G 9: 106,437,627 probably null Het
Adk A G 14: 21,076,308 M1V probably null Het
Ahi1 A G 10: 20,963,691 D167G probably benign Het
Ankrd16 T C 2: 11,786,243 V290A possibly damaging Het
Arhgef5 T A 6: 43,274,417 S701T possibly damaging Het
Atp13a5 C A 16: 29,281,951 M673I probably damaging Het
BC005624 T C 2: 30,978,928 D78G possibly damaging Het
Bcat2 C T 7: 45,589,321 H347Y probably damaging Het
Bpifb4 A G 2: 153,942,627 Y85C possibly damaging Het
Cdc42 T A 4: 137,322,621 probably null Het
Cep170 G A 1: 176,761,437 L541F possibly damaging Het
Ctrc C T 4: 141,841,568 C108Y probably damaging Het
Cyp2u1 C T 3: 131,298,296 V192M possibly damaging Het
Dhx38 A T 8: 109,552,675 L1013Q probably damaging Het
Dnah1 T A 14: 31,287,776 N1945I probably damaging Het
Dnah10 C G 5: 124,821,450 N3765K possibly damaging Het
Dnah17 C A 11: 118,060,079 R2906L possibly damaging Het
Dnajc10 C T 2: 80,331,336 T306I probably benign Het
Efemp2 T A 19: 5,480,245 C287S probably damaging Het
Efna1 T C 3: 89,272,784 R143G probably benign Het
Emilin1 A C 5: 30,917,077 N221H probably damaging Het
Epg5 A G 18: 77,948,609 T174A probably benign Het
Fam184b T A 5: 45,532,901 probably null Het
Fchsd2 T A 7: 101,277,414 C570* probably null Het
Gm4787 A T 12: 81,379,200 D61E probably benign Het
Gm7356 C T 17: 14,001,663 G35R probably damaging Het
Gm8220 A G 14: 44,288,188 T20A probably damaging Het
Hivep2 C T 10: 14,128,501 T281M probably damaging Het
Ighv2-9-1 A G 12: 113,770,072 V43A probably damaging Het
Klhl33 A T 14: 50,891,916 C619S probably benign Het
Kmt2a A T 9: 44,829,261 probably benign Het
Lax1 A G 1: 133,680,158 C282R probably benign Het
Lrrd1 A G 5: 3,851,395 K567E probably benign Het
Luzp1 C T 4: 136,540,813 R116* probably null Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Macrod2 A T 2: 140,419,913 N38I probably damaging Het
Map3k14 A T 11: 103,242,132 I80N probably damaging Het
Mcm9 A G 10: 53,620,203 S368P probably benign Het
Mfge8 T C 7: 79,143,301 D139G probably benign Het
Mmp19 A T 10: 128,791,654 I54F probably benign Het
Myo15 G T 11: 60,499,494 W2114L probably damaging Het
Myo1a G T 10: 127,710,458 V277L probably benign Het
Myoc A G 1: 162,639,346 D28G probably damaging Het
Myrf G T 19: 10,219,560 N487K probably damaging Het
Olfr1093 C G 2: 86,786,155 L142V probably damaging Het
Olfr429 G A 1: 174,089,750 A237T probably damaging Het
Olfr703 G T 7: 106,844,802 G64* probably null Het
Omd T A 13: 49,590,234 F253L probably damaging Het
Papss1 T G 3: 131,599,971 I238S probably damaging Het
Pkhd1 A T 1: 20,562,451 F580Y probably benign Het
Polk T A 13: 96,516,681 K70N probably damaging Het
Ppig T A 2: 69,732,411 D31E probably benign Het
Ppp6r1 G T 7: 4,633,292 S766R possibly damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Reln T C 5: 21,985,857 I1511V probably benign Het
Rnh1 T C 7: 141,163,183 N268S probably damaging Het
Rpia A G 6: 70,773,440 V236A probably benign Het
Rpl10a G T 17: 28,329,450 V80L probably benign Het
Sap130 T G 18: 31,666,354 S295A possibly damaging Het
Sgms1 C T 19: 32,142,793 V238I probably benign Het
Sh3tc1 A G 5: 35,707,434 S470P probably benign Het
Slc25a32 A G 15: 39,097,589 V233A possibly damaging Het
Slc2a2 T C 3: 28,717,519 S158P probably benign Het
Slc6a2 A G 8: 92,996,025 Y550C probably benign Het
Slc7a9 C A 7: 35,452,511 T77K probably benign Het
Snd1 A T 6: 28,626,101 D385V probably benign Het
Ssh3 A T 19: 4,264,420 F369I probably damaging Het
Syk A G 13: 52,612,459 probably null Het
Tbc1d16 A G 11: 119,208,916 S211P probably damaging Het
Ttc3 A G 16: 94,443,453 T1439A probably benign Het
Usp18 A G 6: 121,252,514 M31V probably benign Het
Vav1 G T 17: 57,302,330 E415D possibly damaging Het
Vps13a A T 19: 16,678,075 V1863D probably benign Het
Xdh T A 17: 73,922,562 I299F probably damaging Het
Zc3h14 A G 12: 98,771,077 probably benign Het
Zfp345 G A 2: 150,473,411 H69Y probably damaging Het
Zfp652 G T 11: 95,763,841 V357L probably benign Het
Zfp712 A T 13: 67,040,827 Y545* probably null Het
Zgrf1 T C 3: 127,559,632 probably null Het
Other mutations in Cgrrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Cgrrf1 APN 14 46832322 missense probably damaging 0.99
IGL02507:Cgrrf1 APN 14 46853444 nonsense probably null
IGL03298:Cgrrf1 APN 14 46846321 missense probably benign 0.08
R0152:Cgrrf1 UTSW 14 46853913 missense probably damaging 1.00
R1477:Cgrrf1 UTSW 14 46853438 missense probably benign 0.12
R2020:Cgrrf1 UTSW 14 46830445 unclassified probably benign
R2107:Cgrrf1 UTSW 14 46853376 splice site probably benign
R3010:Cgrrf1 UTSW 14 46853766 missense probably benign
R3801:Cgrrf1 UTSW 14 46832363 missense probably damaging 1.00
R4296:Cgrrf1 UTSW 14 46832355 missense probably damaging 0.99
R4681:Cgrrf1 UTSW 14 46853826 missense probably benign 0.00
R4884:Cgrrf1 UTSW 14 46853455 missense possibly damaging 0.82
R6010:Cgrrf1 UTSW 14 46853701 missense probably damaging 0.99
R6299:Cgrrf1 UTSW 14 46840190 missense probably damaging 1.00
R6861:Cgrrf1 UTSW 14 46832328 missense probably damaging 1.00
R6986:Cgrrf1 UTSW 14 46832129 unclassified probably benign
R7132:Cgrrf1 UTSW 14 46853864 missense probably damaging 1.00
R7152:Cgrrf1 UTSW 14 46853477 nonsense probably null
R7694:Cgrrf1 UTSW 14 46853958 missense possibly damaging 0.79
R8081:Cgrrf1 UTSW 14 46854011 missense probably benign 0.03
R8158:Cgrrf1 UTSW 14 46853735 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTATAGAGATCAAGGAGTGGCTG -3'
(R):5'- AAGTAGCGCACACAGCTGTC -3'

Sequencing Primer
(F):5'- ATCAAGGAGTGGCTGTTTTTAAAGAG -3'
(R):5'- ACACAGCTGTCGCACAGG -3'
Posted On2018-11-06