Incidental Mutation 'R6932:Cep170'
ID540065
Institutional Source Beutler Lab
Gene Symbol Cep170
Ensembl Gene ENSMUSG00000057335
Gene Namecentrosomal protein 170
Synonyms4933426L22Rik, A330004A13Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001099637.2; MGI:1918348

Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R6932 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location176733653-176814067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 176761437 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 541 (L541F)
Ref Sequence ENSEMBL: ENSMUSP00000141769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057037] [ENSMUST00000192927] [ENSMUST00000194727] [ENSMUST00000195433] [ENSMUST00000195717]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057037
AA Change: L541F

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000059562
Gene: ENSMUSG00000057335
AA Change: L541F

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 801 1496 3.3e-264 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192927
SMART Domains Protein: ENSMUSP00000142032
Gene: ENSMUSG00000057335

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:CEP170_C 30 469 3.4e-129 PFAM
Pfam:CEP170_C 449 708 7.4e-102 PFAM
low complexity region 742 754 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194727
AA Change: L541F

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141793
Gene: ENSMUSG00000057335
AA Change: L541F

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1509 8e-260 PFAM
low complexity region 1543 1555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195433
SMART Domains Protein: ENSMUSP00000142108
Gene: ENSMUSG00000057335

DomainStartEndE-ValueType
FHA 22 73 6.1e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195717
AA Change: L541F

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141769
Gene: ENSMUSG00000057335
AA Change: L541F

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1499 1.8e-261 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. During interphase, the encoded protein localizes to the sub-distal appendages of mature centrioles, which are microtubule-based structures thought to help organize centrosomes. During mitosis, the protein associates with spindle microtubules near the centrosomes. The protein interacts with and is phosphorylated by polo-like kinase 1, and functions in maintaining microtubule organization and cell morphology. The human genome contains a putative transcribed pseudogene. Several alternatively spliced transcript variants of this gene have been found, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(29) : Gene trapped(29)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932443I19Rik CA CAA 8: 13,734,865 probably null Het
Acads A T 5: 115,112,272 F198I probably damaging Het
Acy1 A G 9: 106,437,627 probably null Het
Adk A G 14: 21,076,308 M1V probably null Het
Ahi1 A G 10: 20,963,691 D167G probably benign Het
Ankrd16 T C 2: 11,786,243 V290A possibly damaging Het
Arhgef5 T A 6: 43,274,417 S701T possibly damaging Het
Atp13a5 C A 16: 29,281,951 M673I probably damaging Het
BC005624 T C 2: 30,978,928 D78G possibly damaging Het
Bcat2 C T 7: 45,589,321 H347Y probably damaging Het
Bpifb4 A G 2: 153,942,627 Y85C possibly damaging Het
Cdc42 T A 4: 137,322,621 probably null Het
Cgrrf1 T A 14: 46,853,722 N234K probably benign Het
Ctrc C T 4: 141,841,568 C108Y probably damaging Het
Cyp2u1 C T 3: 131,298,296 V192M possibly damaging Het
Dhx38 A T 8: 109,552,675 L1013Q probably damaging Het
Dnah1 T A 14: 31,287,776 N1945I probably damaging Het
Dnah10 C G 5: 124,821,450 N3765K possibly damaging Het
Dnah17 C A 11: 118,060,079 R2906L possibly damaging Het
Dnajc10 C T 2: 80,331,336 T306I probably benign Het
Efemp2 T A 19: 5,480,245 C287S probably damaging Het
Efna1 T C 3: 89,272,784 R143G probably benign Het
Emilin1 A C 5: 30,917,077 N221H probably damaging Het
Epg5 A G 18: 77,948,609 T174A probably benign Het
Fam184b T A 5: 45,532,901 probably null Het
Fchsd2 T A 7: 101,277,414 C570* probably null Het
Gm4787 A T 12: 81,379,200 D61E probably benign Het
Gm7356 C T 17: 14,001,663 G35R probably damaging Het
Gm8220 A G 14: 44,288,188 T20A probably damaging Het
Hivep2 C T 10: 14,128,501 T281M probably damaging Het
Ighv2-9-1 A G 12: 113,770,072 V43A probably damaging Het
Klhl33 A T 14: 50,891,916 C619S probably benign Het
Kmt2a A T 9: 44,829,261 probably benign Het
Lax1 A G 1: 133,680,158 C282R probably benign Het
Lrrd1 A G 5: 3,851,395 K567E probably benign Het
Luzp1 C T 4: 136,540,813 R116* probably null Het
Lypd3 G C 7: 24,638,433 G75R probably damaging Het
Macrod2 A T 2: 140,419,913 N38I probably damaging Het
Map3k14 A T 11: 103,242,132 I80N probably damaging Het
Mcm9 A G 10: 53,620,203 S368P probably benign Het
Mfge8 T C 7: 79,143,301 D139G probably benign Het
Mmp19 A T 10: 128,791,654 I54F probably benign Het
Myo15 G T 11: 60,499,494 W2114L probably damaging Het
Myo1a G T 10: 127,710,458 V277L probably benign Het
Myoc A G 1: 162,639,346 D28G probably damaging Het
Myrf G T 19: 10,219,560 N487K probably damaging Het
Olfr1093 C G 2: 86,786,155 L142V probably damaging Het
Olfr429 G A 1: 174,089,750 A237T probably damaging Het
Olfr703 G T 7: 106,844,802 G64* probably null Het
Omd T A 13: 49,590,234 F253L probably damaging Het
Papss1 T G 3: 131,599,971 I238S probably damaging Het
Pkhd1 A T 1: 20,562,451 F580Y probably benign Het
Polk T A 13: 96,516,681 K70N probably damaging Het
Ppig T A 2: 69,732,411 D31E probably benign Het
Ppp6r1 G T 7: 4,633,292 S766R possibly damaging Het
Rab11fip5 T C 6: 85,341,558 D783G probably benign Het
Reln T C 5: 21,985,857 I1511V probably benign Het
Rnh1 T C 7: 141,163,183 N268S probably damaging Het
Rpia A G 6: 70,773,440 V236A probably benign Het
Rpl10a G T 17: 28,329,450 V80L probably benign Het
Sap130 T G 18: 31,666,354 S295A possibly damaging Het
Sgms1 C T 19: 32,142,793 V238I probably benign Het
Sh3tc1 A G 5: 35,707,434 S470P probably benign Het
Slc25a32 A G 15: 39,097,589 V233A possibly damaging Het
Slc2a2 T C 3: 28,717,519 S158P probably benign Het
Slc6a2 A G 8: 92,996,025 Y550C probably benign Het
Slc7a9 C A 7: 35,452,511 T77K probably benign Het
Snd1 A T 6: 28,626,101 D385V probably benign Het
Ssh3 A T 19: 4,264,420 F369I probably damaging Het
Syk A G 13: 52,612,459 probably null Het
Tbc1d16 A G 11: 119,208,916 S211P probably damaging Het
Ttc3 A G 16: 94,443,453 T1439A probably benign Het
Usp18 A G 6: 121,252,514 M31V probably benign Het
Vav1 G T 17: 57,302,330 E415D possibly damaging Het
Vps13a A T 19: 16,678,075 V1863D probably benign Het
Xdh T A 17: 73,922,562 I299F probably damaging Het
Zc3h14 A G 12: 98,771,077 probably benign Het
Zfp345 G A 2: 150,473,411 H69Y probably damaging Het
Zfp652 G T 11: 95,763,841 V357L probably benign Het
Zfp712 A T 13: 67,040,827 Y545* probably null Het
Zgrf1 T C 3: 127,559,632 probably null Het
Other mutations in Cep170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cep170 APN 1 176755399 missense probably damaging 1.00
IGL00925:Cep170 APN 1 176793524 missense probably damaging 1.00
IGL00972:Cep170 APN 1 176735696 missense probably benign 0.00
IGL01488:Cep170 APN 1 176756375 missense probably benign 0.00
IGL01916:Cep170 APN 1 176739910 splice site probably benign
IGL02212:Cep170 APN 1 176735936 missense probably damaging 0.99
IGL02269:Cep170 APN 1 176769366 missense probably benign
IGL02732:Cep170 APN 1 176736874 missense probably damaging 1.00
IGL02740:Cep170 APN 1 176793600 missense probably damaging 1.00
IGL02812:Cep170 APN 1 176742514 missense probably damaging 1.00
IGL03036:Cep170 APN 1 176769337 missense possibly damaging 0.87
IGL03201:Cep170 APN 1 176736888 missense probably damaging 1.00
IGL03333:Cep170 APN 1 176769526 missense possibly damaging 0.64
PIT4520001:Cep170 UTSW 1 176780199 missense unknown
R0031:Cep170 UTSW 1 176756091 missense probably damaging 1.00
R0039:Cep170 UTSW 1 176782495 critical splice donor site probably null
R0053:Cep170 UTSW 1 176782380 missense possibly damaging 0.82
R0053:Cep170 UTSW 1 176782380 missense possibly damaging 0.82
R0113:Cep170 UTSW 1 176758455 missense probably damaging 0.97
R0144:Cep170 UTSW 1 176792595 missense probably benign 0.01
R0613:Cep170 UTSW 1 176774680 missense probably benign
R0755:Cep170 UTSW 1 176755753 missense probably damaging 1.00
R1132:Cep170 UTSW 1 176750037 missense probably damaging 1.00
R1367:Cep170 UTSW 1 176735724 missense probably damaging 0.99
R1399:Cep170 UTSW 1 176758403 missense probably damaging 0.98
R1462:Cep170 UTSW 1 176756645 missense possibly damaging 0.46
R1462:Cep170 UTSW 1 176756645 missense possibly damaging 0.46
R1481:Cep170 UTSW 1 176782385 missense possibly damaging 0.56
R1526:Cep170 UTSW 1 176788505 missense probably damaging 1.00
R1540:Cep170 UTSW 1 176739932 missense probably damaging 1.00
R1552:Cep170 UTSW 1 176782494 splice site probably benign
R1570:Cep170 UTSW 1 176755801 missense possibly damaging 0.64
R1846:Cep170 UTSW 1 176755769 missense probably damaging 1.00
R1884:Cep170 UTSW 1 176774679 missense probably benign 0.12
R1945:Cep170 UTSW 1 176793534 nonsense probably null
R1954:Cep170 UTSW 1 176756384 missense probably benign
R1957:Cep170 UTSW 1 176769447 missense probably benign 0.24
R2184:Cep170 UTSW 1 176756976 missense probably benign 0.00
R2280:Cep170 UTSW 1 176774505 missense probably benign 0.17
R2426:Cep170 UTSW 1 176774635 missense probably benign
R3415:Cep170 UTSW 1 176756044 missense probably damaging 1.00
R3417:Cep170 UTSW 1 176756044 missense probably damaging 1.00
R3752:Cep170 UTSW 1 176782495 critical splice donor site probably benign
R3848:Cep170 UTSW 1 176755843 missense probably benign 0.14
R3849:Cep170 UTSW 1 176755843 missense probably benign 0.14
R4752:Cep170 UTSW 1 176756688 missense probably benign 0.00
R4910:Cep170 UTSW 1 176782263 missense possibly damaging 0.94
R5007:Cep170 UTSW 1 176769814 missense probably benign 0.28
R5052:Cep170 UTSW 1 176793551 missense probably damaging 1.00
R5093:Cep170 UTSW 1 176769330 missense possibly damaging 0.95
R5530:Cep170 UTSW 1 176769510 missense probably benign 0.00
R5622:Cep170 UTSW 1 176735867 missense possibly damaging 0.64
R5892:Cep170 UTSW 1 176755387 unclassified probably null
R5942:Cep170 UTSW 1 176756419 missense probably damaging 1.00
R6083:Cep170 UTSW 1 176774625 missense probably damaging 1.00
R6091:Cep170 UTSW 1 176755831 missense probably damaging 0.98
R6190:Cep170 UTSW 1 176782409 missense probably damaging 1.00
R6253:Cep170 UTSW 1 176780394 missense possibly damaging 0.71
R6476:Cep170 UTSW 1 176780351 missense possibly damaging 0.72
R6622:Cep170 UTSW 1 176756332 missense probably damaging 1.00
R7030:Cep170 UTSW 1 176756485 missense probably damaging 0.99
R7163:Cep170 UTSW 1 176774465 missense probably damaging 1.00
R7352:Cep170 UTSW 1 176769857 missense probably benign 0.11
R7499:Cep170 UTSW 1 176774462 missense probably damaging 1.00
R7502:Cep170 UTSW 1 176756029 missense probably damaging 1.00
R7773:Cep170 UTSW 1 176740076 missense
R8043:Cep170 UTSW 1 176769242 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTCACTCACTAACACTGAAAGGAC -3'
(R):5'- TCTGAAATTGCCAGCTGAGG -3'

Sequencing Primer
(F):5'- ACACTGAAAGGACAATGAAAACTAG -3'
(R):5'- AATTGCCAGCTGAGGGTAATTTAG -3'
Posted On2018-11-06