Incidental Mutation 'R6936:Serpinb5'
ID540273
Institutional Source Beutler Lab
Gene Symbol Serpinb5
Ensembl Gene ENSMUSG00000067006
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 5
Synonymsovalbumin, 1110036M19Rik, Maspin, Spi7
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R6936 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location106861173-106883348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106870418 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 46 (T46S)
Ref Sequence ENSEMBL: ENSMUSP00000108350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086701] [ENSMUST00000112729] [ENSMUST00000112730] [ENSMUST00000188745]
Predicted Effect probably benign
Transcript: ENSMUST00000086701
AA Change: T46S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000083908
Gene: ENSMUSG00000067006
AA Change: T46S

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112729
AA Change: T46S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108349
Gene: ENSMUSG00000067006
AA Change: T46S

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112730
AA Change: T46S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000108350
Gene: ENSMUSG00000067006
AA Change: T46S

DomainStartEndE-ValueType
SERPIN 13 375 9.76e-160 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188745
SMART Domains Protein: ENSMUSP00000140264
Gene: ENSMUSG00000067006

DomainStartEndE-ValueType
Pfam:Serpin 1 74 1.6e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.7%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for one null allele displayed peri-implantation lethality with impaired endoderm development and attenuated inner cell mass growth. Mice homozygous for another null allele were viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,568 I2772F probably damaging Het
Adam1a A G 5: 121,519,362 C623R probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ak4 C T 4: 101,447,259 A82V probably benign Het
Arhgap10 A T 8: 77,310,747 C617* probably null Het
Art1 A T 7: 102,106,770 D56V possibly damaging Het
Ascc3 A G 10: 50,729,961 D1392G probably damaging Het
Bbs5 T C 2: 69,654,354 S123P probably damaging Het
Cabin1 A T 10: 75,715,758 probably null Het
Carmil3 G A 14: 55,501,561 E891K probably benign Het
Cbfa2t3 C G 8: 122,647,739 R89P probably damaging Het
Ccdc157 A G 11: 4,144,030 S534P probably benign Het
Cep72 A T 13: 74,040,087 I229N probably damaging Het
Cnn3 C T 3: 121,450,053 probably benign Het
Cyp2c70 A G 19: 40,167,563 V181A probably damaging Het
Cyp2d26 C T 15: 82,792,540 D202N probably benign Het
Dbh A G 2: 27,172,797 K343E probably benign Het
Dlx5 A G 6: 6,879,585 Y161H probably damaging Het
Dnah5 A T 15: 28,409,268 I3611F probably damaging Het
Egf A C 3: 129,681,204 F563V possibly damaging Het
Enpp1 T C 10: 24,651,339 H650R probably benign Het
Exoc6 A G 19: 37,571,863 I109M probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgg C T 3: 83,008,420 S56F possibly damaging Het
Fras1 A G 5: 96,768,352 D3415G possibly damaging Het
Ghsr A G 3: 27,372,325 I177V probably benign Het
Gm1979 A T 5: 26,002,030 H62Q probably benign Het
Gpatch2 A G 1: 187,233,236 D313G probably benign Het
Gtf2i C T 5: 134,242,785 E823K probably damaging Het
Hook2 C A 8: 85,002,998 T689N probably benign Het
Hrnr A T 3: 93,332,360 N3302Y unknown Het
Igkv7-33 G A 6: 70,058,801 P66S possibly damaging Het
Kcnh2 T A 5: 24,324,339 I800F probably damaging Het
Mcmbp G A 7: 128,725,196 Q21* probably null Het
Mmp21 T C 7: 133,678,975 K89E probably benign Het
Olfr142 A G 2: 90,252,334 V218A probably benign Het
Olfr584 A T 7: 103,085,814 I94F probably damaging Het
Pcdhga4 A G 18: 37,687,405 D669G possibly damaging Het
Ralgapa1 T C 12: 55,786,212 T169A probably damaging Het
Sec31a T C 5: 100,392,510 N35S probably benign Het
Svs2 A G 2: 164,237,628 S120P possibly damaging Het
Tbpl2 T C 2: 24,094,941 T64A probably benign Het
Tecpr2 T A 12: 110,944,863 H1111Q possibly damaging Het
Tm9sf3 A G 19: 41,223,199 F402L probably benign Het
Tmem120b T G 5: 123,116,224 V287G possibly damaging Het
Tmem150c T C 5: 100,083,718 T133A possibly damaging Het
Ubqln3 A T 7: 104,142,310 V191D probably damaging Het
Ubr2 T C 17: 46,973,031 E564G possibly damaging Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Serpinb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02237:Serpinb5 APN 1 106880326 missense probably benign 0.01
R1385:Serpinb5 UTSW 1 106876123 missense probably damaging 1.00
R1480:Serpinb5 UTSW 1 106881707 missense probably benign
R1497:Serpinb5 UTSW 1 106876052 missense probably benign 0.08
R1503:Serpinb5 UTSW 1 106870289 missense possibly damaging 0.76
R1933:Serpinb5 UTSW 1 106876121 missense probably damaging 0.99
R2400:Serpinb5 UTSW 1 106881952 missense probably damaging 0.98
R2567:Serpinb5 UTSW 1 106875146 missense probably benign 0.33
R2923:Serpinb5 UTSW 1 106876040 missense probably benign
R3148:Serpinb5 UTSW 1 106881825 missense probably damaging 1.00
R3820:Serpinb5 UTSW 1 106875072 nonsense probably null
R4667:Serpinb5 UTSW 1 106872295 missense probably benign 0.00
R4814:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4815:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4816:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R4817:Serpinb5 UTSW 1 106872339 missense probably damaging 1.00
R5369:Serpinb5 UTSW 1 106881757 missense possibly damaging 0.85
R6108:Serpinb5 UTSW 1 106881728 missense probably damaging 1.00
R6222:Serpinb5 UTSW 1 106870340 missense probably benign 0.09
R6251:Serpinb5 UTSW 1 106875065 missense possibly damaging 0.96
R6349:Serpinb5 UTSW 1 106881765 missense probably benign 0.44
R6977:Serpinb5 UTSW 1 106872347 missense probably benign 0.20
R7332:Serpinb5 UTSW 1 106872361 missense probably benign 0.00
R7369:Serpinb5 UTSW 1 106875149 missense probably benign 0.29
R7443:Serpinb5 UTSW 1 106881970 missense probably benign 0.00
R7499:Serpinb5 UTSW 1 106872389 critical splice donor site probably null
R7724:Serpinb5 UTSW 1 106875142 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTGGGAACACATTTTGCATTAG -3'
(R):5'- CCATCTCAATCCGGTACCTG -3'

Sequencing Primer
(F):5'- AGAAATTAAGTTTTGTGCTTGGTTC -3'
(R):5'- CCGGTACCTGTTCTAAATATAGGTTC -3'
Posted On2018-11-06