Incidental Mutation 'R6936:Ghsr'
ID540280
Institutional Source Beutler Lab
Gene Symbol Ghsr
Ensembl Gene ENSMUSG00000051136
Gene Namegrowth hormone secretagogue receptor
SynonymsC530020I22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6936 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location27371351-27378010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27372325 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 177 (I177V)
Ref Sequence ENSEMBL: ENSMUSP00000061153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057186]
Predicted Effect probably benign
Transcript: ENSMUST00000057186
AA Change: I177V

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000061153
Gene: ENSMUSG00000051136
AA Change: I177V

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
Pfam:7TM_GPCR_Srw 47 339 5.8e-12 PFAM
Pfam:7TM_GPCR_Srsx 53 336 9.4e-8 PFAM
Pfam:7tm_1 59 321 7.9e-51 PFAM
Pfam:7TM_GPCR_Srv 61 338 4.8e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein coupled receptor family. The encoded protein may play a role in energy homeostasis and regulation of body weight. Two identified transcript variants are expressed in several tissues and are evolutionary conserved in fish and swine. One transcript, 1a, excises an intron and encodes the functional protein; this protein is the receptor for the Ghrelin ligand and defines a neuroendocrine pathway for growth hormone release. The second transcript (1b) retains the intron and does not function as a receptor for Ghrelin; however, it may function to attenuate activity of isoform 1a. Mutations in this gene are associated with autosomal idiopathic short stature.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homeostasis is disrupted by inactivation of this gene, namely growth hormone release and appetite stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,568 I2772F probably damaging Het
Adam1a A G 5: 121,519,362 C623R probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ak4 C T 4: 101,447,259 A82V probably benign Het
Arhgap10 A T 8: 77,310,747 C617* probably null Het
Art1 A T 7: 102,106,770 D56V possibly damaging Het
Ascc3 A G 10: 50,729,961 D1392G probably damaging Het
Bbs5 T C 2: 69,654,354 S123P probably damaging Het
Cabin1 A T 10: 75,715,758 probably null Het
Carmil3 G A 14: 55,501,561 E891K probably benign Het
Cbfa2t3 C G 8: 122,647,739 R89P probably damaging Het
Ccdc157 A G 11: 4,144,030 S534P probably benign Het
Cep72 A T 13: 74,040,087 I229N probably damaging Het
Cnn3 C T 3: 121,450,053 probably benign Het
Cyp2c70 A G 19: 40,167,563 V181A probably damaging Het
Cyp2d26 C T 15: 82,792,540 D202N probably benign Het
Dbh A G 2: 27,172,797 K343E probably benign Het
Dlx5 A G 6: 6,879,585 Y161H probably damaging Het
Dnah5 A T 15: 28,409,268 I3611F probably damaging Het
Egf A C 3: 129,681,204 F563V possibly damaging Het
Enpp1 T C 10: 24,651,339 H650R probably benign Het
Exoc6 A G 19: 37,571,863 I109M probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgg C T 3: 83,008,420 S56F possibly damaging Het
Fras1 A G 5: 96,768,352 D3415G possibly damaging Het
Gm1979 A T 5: 26,002,030 H62Q probably benign Het
Gpatch2 A G 1: 187,233,236 D313G probably benign Het
Gtf2i C T 5: 134,242,785 E823K probably damaging Het
Hook2 C A 8: 85,002,998 T689N probably benign Het
Hrnr A T 3: 93,332,360 N3302Y unknown Het
Igkv7-33 G A 6: 70,058,801 P66S possibly damaging Het
Kcnh2 T A 5: 24,324,339 I800F probably damaging Het
Mcmbp G A 7: 128,725,196 Q21* probably null Het
Mmp21 T C 7: 133,678,975 K89E probably benign Het
Olfr142 A G 2: 90,252,334 V218A probably benign Het
Olfr584 A T 7: 103,085,814 I94F probably damaging Het
Pcdhga4 A G 18: 37,687,405 D669G possibly damaging Het
Ralgapa1 T C 12: 55,786,212 T169A probably damaging Het
Sec31a T C 5: 100,392,510 N35S probably benign Het
Serpinb5 A T 1: 106,870,418 T46S probably benign Het
Svs2 A G 2: 164,237,628 S120P possibly damaging Het
Tbpl2 T C 2: 24,094,941 T64A probably benign Het
Tecpr2 T A 12: 110,944,863 H1111Q possibly damaging Het
Tm9sf3 A G 19: 41,223,199 F402L probably benign Het
Tmem120b T G 5: 123,116,224 V287G possibly damaging Het
Tmem150c T C 5: 100,083,718 T133A possibly damaging Het
Ubqln3 A T 7: 104,142,310 V191D probably damaging Het
Ubr2 T C 17: 46,973,031 E564G possibly damaging Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Ghsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ghsr APN 3 27374873 missense possibly damaging 0.92
IGL00435:Ghsr APN 3 27372383 missense possibly damaging 0.91
IGL01376:Ghsr APN 3 27371828 missense probably benign
IGL02444:Ghsr APN 3 27372040 missense probably benign 0.17
IGL02650:Ghsr APN 3 27374855 missense probably benign 0.29
IGL02754:Ghsr APN 3 27372496 missense probably damaging 1.00
R0571:Ghsr UTSW 3 27372016 missense probably damaging 1.00
R0825:Ghsr UTSW 3 27374627 missense probably damaging 0.99
R1036:Ghsr UTSW 3 27374720 missense probably damaging 0.98
R1462:Ghsr UTSW 3 27371876 missense probably benign 0.01
R1462:Ghsr UTSW 3 27371876 missense probably benign 0.01
R1529:Ghsr UTSW 3 27372482 missense probably damaging 1.00
R1598:Ghsr UTSW 3 27372277 missense probably benign 0.27
R4846:Ghsr UTSW 3 27371837 missense probably benign
R4951:Ghsr UTSW 3 27372361 missense possibly damaging 0.83
R4993:Ghsr UTSW 3 27372254 missense possibly damaging 0.87
R5055:Ghsr UTSW 3 27372272 missense probably benign 0.28
R6843:Ghsr UTSW 3 27372527 missense probably benign
R7068:Ghsr UTSW 3 27371837 missense probably benign 0.01
R7318:Ghsr UTSW 3 27372467 missense possibly damaging 0.91
R7510:Ghsr UTSW 3 27372374 missense probably benign 0.05
R7889:Ghsr UTSW 3 27372166 missense probably benign 0.00
R7972:Ghsr UTSW 3 27372166 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTATCGGCCCTGGAACTTC -3'
(R):5'- TTCCTCCCGATGAGACTGTAGAG -3'

Sequencing Primer
(F):5'- AACTCTTCCAGTTTGTCAGCGAGAG -3'
(R):5'- TGTAGAGCACAGTGAGGCAG -3'
Posted On2018-11-06