Incidental Mutation 'R6936:Tecpr2'
ID540313
Institutional Source Beutler Lab
Gene Symbol Tecpr2
Ensembl Gene ENSMUSG00000021275
Gene Nametectonin beta-propeller repeat containing 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6936 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location110889264-110972394 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110944863 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1111 (H1111Q)
Ref Sequence ENSEMBL: ENSMUSP00000126749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165978] [ENSMUST00000169597] [ENSMUST00000223210]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165978
AA Change: H1111Q

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127949
Gene: ENSMUSG00000021275
AA Change: H1111Q

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169597
AA Change: H1111Q

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126749
Gene: ENSMUSG00000021275
AA Change: H1111Q

DomainStartEndE-ValueType
WD40 21 61 8.52e1 SMART
WD40 65 105 2.54e2 SMART
WD40 113 155 2.49e-1 SMART
TECPR 280 314 9.81e0 SMART
TECPR 316 353 2.55e0 SMART
low complexity region 392 424 N/A INTRINSIC
low complexity region 464 471 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 655 670 N/A INTRINSIC
TECPR 814 850 2.28e2 SMART
TECPR 898 931 1.79e-1 SMART
TECPR 939 974 5.61e-3 SMART
TECPR 985 1023 1.55e-5 SMART
TECPR 1173 1208 1.29e-2 SMART
TECPR 1216 1255 2.82e-8 SMART
TECPR 1266 1308 1.05e-7 SMART
TECPR 1317 1351 1.42e-4 SMART
TECPR 1360 1394 5.03e-5 SMART
low complexity region 1414 1421 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223210
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 99.0%
  • 20x: 96.7%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tectonin beta-propeller repeat-containing (TECPR) family, and contains both TECPR and tryptophan-aspartic acid repeat (WD repeat) domains. This gene has been implicated in autophagy, as reduced expression levels of this gene have been associated with impaired autophagy. Recessive mutations in this gene have been associated with a hereditary form of spastic paraparesis (HSP). HSP is characterized by progressive spasticity and paralysis of the legs. There is also some evidence linking mutations in this gene with birdshot chorioretinopathy (BSCR), which results in inflammation of the choroid and retina. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,568 I2772F probably damaging Het
Adam1a A G 5: 121,519,362 C623R probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ak4 C T 4: 101,447,259 A82V probably benign Het
Arhgap10 A T 8: 77,310,747 C617* probably null Het
Art1 A T 7: 102,106,770 D56V possibly damaging Het
Ascc3 A G 10: 50,729,961 D1392G probably damaging Het
Bbs5 T C 2: 69,654,354 S123P probably damaging Het
Cabin1 A T 10: 75,715,758 probably null Het
Carmil3 G A 14: 55,501,561 E891K probably benign Het
Cbfa2t3 C G 8: 122,647,739 R89P probably damaging Het
Ccdc157 A G 11: 4,144,030 S534P probably benign Het
Cep72 A T 13: 74,040,087 I229N probably damaging Het
Cnn3 C T 3: 121,450,053 probably benign Het
Cyp2c70 A G 19: 40,167,563 V181A probably damaging Het
Cyp2d26 C T 15: 82,792,540 D202N probably benign Het
Dbh A G 2: 27,172,797 K343E probably benign Het
Dlx5 A G 6: 6,879,585 Y161H probably damaging Het
Dnah5 A T 15: 28,409,268 I3611F probably damaging Het
Egf A C 3: 129,681,204 F563V possibly damaging Het
Enpp1 T C 10: 24,651,339 H650R probably benign Het
Exoc6 A G 19: 37,571,863 I109M probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgg C T 3: 83,008,420 S56F possibly damaging Het
Fras1 A G 5: 96,768,352 D3415G possibly damaging Het
Ghsr A G 3: 27,372,325 I177V probably benign Het
Gm1979 A T 5: 26,002,030 H62Q probably benign Het
Gpatch2 A G 1: 187,233,236 D313G probably benign Het
Gtf2i C T 5: 134,242,785 E823K probably damaging Het
Hook2 C A 8: 85,002,998 T689N probably benign Het
Hrnr A T 3: 93,332,360 N3302Y unknown Het
Igkv7-33 G A 6: 70,058,801 P66S possibly damaging Het
Kcnh2 T A 5: 24,324,339 I800F probably damaging Het
Mcmbp G A 7: 128,725,196 Q21* probably null Het
Mmp21 T C 7: 133,678,975 K89E probably benign Het
Olfr142 A G 2: 90,252,334 V218A probably benign Het
Olfr584 A T 7: 103,085,814 I94F probably damaging Het
Pcdhga4 A G 18: 37,687,405 D669G possibly damaging Het
Ralgapa1 T C 12: 55,786,212 T169A probably damaging Het
Sec31a T C 5: 100,392,510 N35S probably benign Het
Serpinb5 A T 1: 106,870,418 T46S probably benign Het
Svs2 A G 2: 164,237,628 S120P possibly damaging Het
Tbpl2 T C 2: 24,094,941 T64A probably benign Het
Tm9sf3 A G 19: 41,223,199 F402L probably benign Het
Tmem120b T G 5: 123,116,224 V287G possibly damaging Het
Tmem150c T C 5: 100,083,718 T133A possibly damaging Het
Ubqln3 A T 7: 104,142,310 V191D probably damaging Het
Ubr2 T C 17: 46,973,031 E564G possibly damaging Het
Zkscan1 T C 5: 138,093,305 V100A probably damaging Het
Other mutations in Tecpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Tecpr2 APN 12 110967779 missense possibly damaging 0.67
IGL01759:Tecpr2 APN 12 110931392 utr 3 prime probably benign
IGL02114:Tecpr2 APN 12 110968887 missense probably damaging 1.00
IGL02813:Tecpr2 APN 12 110933192 missense probably damaging 1.00
IGL02943:Tecpr2 APN 12 110967749 missense probably benign
IGL03085:Tecpr2 APN 12 110954826 splice site probably benign
IGL03290:Tecpr2 APN 12 110967833 missense possibly damaging 0.65
R0362:Tecpr2 UTSW 12 110968940 missense probably damaging 0.96
R0486:Tecpr2 UTSW 12 110896369 missense probably benign 0.01
R0662:Tecpr2 UTSW 12 110896228 missense probably benign 0.02
R0787:Tecpr2 UTSW 12 110946343 missense probably benign 0.30
R1147:Tecpr2 UTSW 12 110941438 splice site probably benign
R1454:Tecpr2 UTSW 12 110968953 missense probably benign 0.00
R1513:Tecpr2 UTSW 12 110954800 missense possibly damaging 0.94
R1567:Tecpr2 UTSW 12 110941596 critical splice donor site probably null
R1569:Tecpr2 UTSW 12 110944887 critical splice donor site probably null
R1818:Tecpr2 UTSW 12 110926454 missense probably damaging 1.00
R1856:Tecpr2 UTSW 12 110933064 missense probably benign
R1897:Tecpr2 UTSW 12 110933247 missense probably benign
R1903:Tecpr2 UTSW 12 110947912 missense probably damaging 0.98
R1939:Tecpr2 UTSW 12 110933169 missense probably damaging 0.98
R1982:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R2073:Tecpr2 UTSW 12 110968429 missense possibly damaging 0.51
R2393:Tecpr2 UTSW 12 110926402 missense probably damaging 0.99
R2443:Tecpr2 UTSW 12 110896325 missense probably damaging 1.00
R2484:Tecpr2 UTSW 12 110933318 missense probably benign
R4564:Tecpr2 UTSW 12 110954785 missense probably benign 0.07
R4723:Tecpr2 UTSW 12 110932976 missense probably benign 0.01
R4835:Tecpr2 UTSW 12 110954730 missense probably benign 0.00
R4847:Tecpr2 UTSW 12 110939877 missense probably damaging 1.00
R4911:Tecpr2 UTSW 12 110931487 missense possibly damaging 0.74
R5179:Tecpr2 UTSW 12 110944693 missense possibly damaging 0.63
R5266:Tecpr2 UTSW 12 110915402 missense probably damaging 1.00
R5386:Tecpr2 UTSW 12 110915453 missense probably damaging 1.00
R5486:Tecpr2 UTSW 12 110933015 missense probably benign 0.03
R5490:Tecpr2 UTSW 12 110914684 missense probably damaging 1.00
R5627:Tecpr2 UTSW 12 110941482 missense probably damaging 0.97
R5836:Tecpr2 UTSW 12 110931511 missense possibly damaging 0.76
R6052:Tecpr2 UTSW 12 110918891 missense possibly damaging 0.89
R6084:Tecpr2 UTSW 12 110929109 missense probably damaging 0.98
R6306:Tecpr2 UTSW 12 110944751 missense probably damaging 1.00
R6563:Tecpr2 UTSW 12 110929087 missense probably benign 0.00
R6977:Tecpr2 UTSW 12 110939766 missense probably benign 0.17
R7110:Tecpr2 UTSW 12 110918972 missense probably damaging 1.00
R7132:Tecpr2 UTSW 12 110915372 missense probably damaging 0.97
R7353:Tecpr2 UTSW 12 110967844 missense probably benign 0.06
R7362:Tecpr2 UTSW 12 110941476 missense possibly damaging 0.85
R7366:Tecpr2 UTSW 12 110915480 critical splice donor site probably null
R7404:Tecpr2 UTSW 12 110931604 missense probably benign 0.00
R7478:Tecpr2 UTSW 12 110968439 missense probably benign 0.36
R7774:Tecpr2 UTSW 12 110933172 missense probably benign 0.00
R7997:Tecpr2 UTSW 12 110933603 missense probably benign 0.02
R8037:Tecpr2 UTSW 12 110936420 missense probably benign 0.03
R8038:Tecpr2 UTSW 12 110936420 missense probably benign 0.03
Z1176:Tecpr2 UTSW 12 110896310 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCAGACCATCATGCATGCC -3'
(R):5'- TCGTCCAGACACCAAGTTTTAG -3'

Sequencing Primer
(F):5'- TGCATGCCACACACTCGGTAG -3'
(R):5'- CGTCCAGACACCAAGTTTTAGGAATG -3'
Posted On2018-11-06