Incidental Mutation 'R6986:Pgbd5'
ID542974
Institutional Source Beutler Lab
Gene Symbol Pgbd5
Ensembl Gene ENSMUSG00000050751
Gene NamepiggyBac transposable element derived 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6986 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location124369049-124439658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124384473 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 160 (E160K)
Ref Sequence ENSEMBL: ENSMUSP00000120984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052580] [ENSMUST00000136892] [ENSMUST00000140012] [ENSMUST00000172566]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052580
AA Change: E46K

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054788
Gene: ENSMUSG00000050751
AA Change: E46K

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 6 372 5e-86 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136892
AA Change: E46K

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123265
Gene: ENSMUSG00000050751
AA Change: E46K

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 6 372 5e-86 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140012
AA Change: E160K

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120984
Gene: ENSMUSG00000050751
AA Change: E160K

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
low complexity region 47 60 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 120 486 5.6e-90 PFAM
low complexity region 506 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172566
AA Change: E69K

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133560
Gene: ENSMUSG00000050751
AA Change: E69K

DomainStartEndE-ValueType
Pfam:DDE_Tnp_1_7 29 395 2e-86 PFAM
low complexity region 415 426 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,311,577 N482D probably damaging Het
Agbl3 A G 6: 34,839,452 K766E probably benign Het
Aldh3a1 T A 11: 61,214,251 I154N probably damaging Het
Cdca2 C T 14: 67,694,997 V486I probably benign Het
Celf3 G C 3: 94,487,717 A313P possibly damaging Het
Cgrrf1 T C 14: 46,832,129 probably benign Het
Chd7 T A 4: 8,859,285 N2458K possibly damaging Het
Chrna5 T A 9: 55,006,457 M429K possibly damaging Het
Cux2 A T 5: 121,868,579 L876Q possibly damaging Het
Cyb5rl T A 4: 107,070,876 S3T probably benign Het
Ehd4 A T 2: 120,097,090 M321K probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Endod1 T C 9: 14,357,310 E293G probably damaging Het
Fam205c A G 4: 42,868,696 V309A possibly damaging Het
Fat3 G A 9: 16,021,335 T1434I probably damaging Het
Flrt2 T A 12: 95,780,685 I599N probably damaging Het
Gm6370 T A 5: 146,493,588 probably null Het
Gm7247 T C 14: 51,365,375 M56T possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hist1h3g A G 13: 23,535,433 probably benign Het
Ints8 T C 4: 11,204,474 Y994C probably damaging Het
Irf1 A G 11: 53,774,140 T165A probably damaging Het
Lgr6 G T 1: 134,993,956 Q217K possibly damaging Het
Lrrc36 T C 8: 105,458,447 S619P probably damaging Het
Marc2 T C 1: 184,841,263 H53R probably benign Het
Morn4 T C 19: 42,078,014 N45D possibly damaging Het
Mtmr3 T C 11: 4,489,692 T583A probably damaging Het
Ncdn A G 4: 126,747,229 Y493H probably damaging Het
Nckap1 T A 2: 80,520,567 Y726F probably benign Het
Olfr225 A G 11: 59,614,098 K378R possibly damaging Het
Olfr822 G A 10: 130,075,330 V307M possibly damaging Het
Optc T A 1: 133,897,964 M275L probably benign Het
Perm1 A T 4: 156,218,519 K507* probably null Het
Polr2k C A 15: 36,175,035 P14T probably benign Het
Ppp2r3d A T 9: 124,439,080 Y112* probably null Het
Pramef17 T A 4: 143,993,318 D159V probably damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Rnls C T 19: 33,382,381 G11D probably damaging Het
Sbf2 T C 7: 110,330,615 T333A probably damaging Het
Scn3a A T 2: 65,508,618 N572K probably damaging Het
Serinc3 A G 2: 163,627,971 L319P probably benign Het
Setbp1 T C 18: 78,857,839 D871G probably damaging Het
Sf3b2 T C 19: 5,279,895 T661A probably benign Het
Sgsm2 T A 11: 74,892,041 R30W probably damaging Het
Sh3tc1 A G 5: 35,723,944 S52P probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Snrpa A T 7: 27,192,964 M57K probably damaging Het
Srbd1 A T 17: 85,985,222 I973N probably damaging Het
Srp72 T A 5: 76,994,876 S428T probably benign Het
Ss18l2 A G 9: 121,712,605 Y50C probably damaging Het
St14 A G 9: 31,096,549 L578P probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmc1 T C 19: 20,824,283 N460D probably benign Het
Tnni3k C T 3: 154,961,864 G280R probably damaging Het
Trpc3 A G 3: 36,655,016 probably null Het
Tshr C T 12: 91,533,957 A152V probably damaging Het
Tuft1 G A 3: 94,614,154 P358S probably damaging Het
Vmn2r120 A T 17: 57,509,340 S672T probably damaging Het
Vmn2r83 G T 10: 79,480,259 E496D probably benign Het
Vmn2r91 A G 17: 18,136,009 N646S probably benign Het
Zfp9 A G 6: 118,464,465 V412A possibly damaging Het
Zmynd8 G T 2: 165,833,415 H273N probably damaging Het
Other mutations in Pgbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Pgbd5 APN 8 124384202 missense probably benign 0.00
IGL01669:Pgbd5 APN 8 124374399 missense possibly damaging 0.86
IGL01759:Pgbd5 APN 8 124384379 missense probably damaging 1.00
IGL01762:Pgbd5 APN 8 124370610 missense probably damaging 1.00
IGL02398:Pgbd5 APN 8 124384518 missense probably damaging 1.00
R0348:Pgbd5 UTSW 8 124434032 missense probably damaging 0.98
R0702:Pgbd5 UTSW 8 124374255 missense probably benign 0.21
R0981:Pgbd5 UTSW 8 124384293 nonsense probably null
R1259:Pgbd5 UTSW 8 124370585 missense probably damaging 0.98
R1598:Pgbd5 UTSW 8 124374287 missense probably benign 0.26
R1609:Pgbd5 UTSW 8 124434011 missense probably benign 0.00
R1742:Pgbd5 UTSW 8 124380307 missense probably damaging 1.00
R1938:Pgbd5 UTSW 8 124374249 nonsense probably null
R1985:Pgbd5 UTSW 8 124370592 missense probably benign 0.00
R2169:Pgbd5 UTSW 8 124384624 critical splice acceptor site probably null
R4573:Pgbd5 UTSW 8 124376227 nonsense probably null
R4917:Pgbd5 UTSW 8 124370566 missense probably benign 0.14
R4918:Pgbd5 UTSW 8 124370566 missense probably benign 0.14
R4946:Pgbd5 UTSW 8 124370585 missense possibly damaging 0.93
R5409:Pgbd5 UTSW 8 124371880 missense probably damaging 1.00
R5885:Pgbd5 UTSW 8 124384466 missense probably damaging 1.00
R5946:Pgbd5 UTSW 8 124374317 missense possibly damaging 0.83
R6907:Pgbd5 UTSW 8 124380282 missense probably damaging 0.97
R7144:Pgbd5 UTSW 8 124374317 missense possibly damaging 0.83
R7342:Pgbd5 UTSW 8 124433970 missense probably benign 0.36
R7475:Pgbd5 UTSW 8 124434011 missense probably benign 0.00
X0067:Pgbd5 UTSW 8 124371912 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCTTGTAGAGCCCATG -3'
(R):5'- GATTTTGGACGTGAGCGCTC -3'

Sequencing Primer
(F):5'- CTGGATCGGAAGGCCACAAC -3'
(R):5'- CAGCCTGTCTTTGGATTTCAG -3'
Posted On2018-11-28