Incidental Mutation 'R6986:Adcy9'
ID542998
Institutional Source Beutler Lab
Gene Symbol Adcy9
Ensembl Gene ENSMUSG00000005580
Gene Nameadenylate cyclase 9
SynonymsD16Wsu65e, ACtp10
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock #R6986 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location4287529-4420498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4311577 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 482 (N482D)
Ref Sequence ENSEMBL: ENSMUSP00000113421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005719] [ENSMUST00000117801] [ENSMUST00000120080]
Predicted Effect probably damaging
Transcript: ENSMUST00000005719
AA Change: N719D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005719
Gene: ENSMUSG00000005580
AA Change: N719D

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117801
AA Change: N719D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113498
Gene: ENSMUSG00000005580
AA Change: N719D

DomainStartEndE-ValueType
low complexity region 6 13 N/A INTRINSIC
low complexity region 49 75 N/A INTRINSIC
transmembrane domain 118 137 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 177 196 N/A INTRINSIC
transmembrane domain 216 235 N/A INTRINSIC
transmembrane domain 242 261 N/A INTRINSIC
transmembrane domain 281 300 N/A INTRINSIC
CYCc 325 547 1.69e-63 SMART
transmembrane domain 791 813 N/A INTRINSIC
transmembrane domain 823 845 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 890 912 N/A INTRINSIC
transmembrane domain 977 996 N/A INTRINSIC
CYCc 1023 1227 1.26e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120080
AA Change: N482D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113421
Gene: ENSMUSG00000005580
AA Change: N482D

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 44 63 N/A INTRINSIC
CYCc 88 310 1.69e-63 SMART
transmembrane domain 554 576 N/A INTRINSIC
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
transmembrane domain 653 675 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
CYCc 786 990 1.26e-39 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. It is regulated by a family of G protein-coupled receptors, protein kinases, and calcium. The type 9 adenylyl cyclase is a widely distributed adenylyl cyclase, and it is stimulated by beta-adrenergic receptor activation but is insensitive to forskolin, calcium, and somatostatin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show an increased IgG1 response to ovalbumin challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A G 6: 34,839,452 K766E probably benign Het
Aldh3a1 T A 11: 61,214,251 I154N probably damaging Het
Cdca2 C T 14: 67,694,997 V486I probably benign Het
Celf3 G C 3: 94,487,717 A313P possibly damaging Het
Cgrrf1 T C 14: 46,832,129 probably benign Het
Chd7 T A 4: 8,859,285 N2458K possibly damaging Het
Chrna5 T A 9: 55,006,457 M429K possibly damaging Het
Cux2 A T 5: 121,868,579 L876Q possibly damaging Het
Cyb5rl T A 4: 107,070,876 S3T probably benign Het
Ehd4 A T 2: 120,097,090 M321K probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Endod1 T C 9: 14,357,310 E293G probably damaging Het
Fam205c A G 4: 42,868,696 V309A possibly damaging Het
Fat3 G A 9: 16,021,335 T1434I probably damaging Het
Flrt2 T A 12: 95,780,685 I599N probably damaging Het
Gm6370 T A 5: 146,493,588 probably null Het
Gm7247 T C 14: 51,365,375 M56T possibly damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Hist1h3g A G 13: 23,535,433 probably benign Het
Ints8 T C 4: 11,204,474 Y994C probably damaging Het
Irf1 A G 11: 53,774,140 T165A probably damaging Het
Lgr6 G T 1: 134,993,956 Q217K possibly damaging Het
Lrrc36 T C 8: 105,458,447 S619P probably damaging Het
Marc2 T C 1: 184,841,263 H53R probably benign Het
Morn4 T C 19: 42,078,014 N45D possibly damaging Het
Mtmr3 T C 11: 4,489,692 T583A probably damaging Het
Ncdn A G 4: 126,747,229 Y493H probably damaging Het
Nckap1 T A 2: 80,520,567 Y726F probably benign Het
Olfr225 A G 11: 59,614,098 K378R possibly damaging Het
Olfr822 G A 10: 130,075,330 V307M possibly damaging Het
Optc T A 1: 133,897,964 M275L probably benign Het
Perm1 A T 4: 156,218,519 K507* probably null Het
Pgbd5 C T 8: 124,384,473 E160K possibly damaging Het
Polr2k C A 15: 36,175,035 P14T probably benign Het
Ppp2r3d A T 9: 124,439,080 Y112* probably null Het
Pramef17 T A 4: 143,993,318 D159V probably damaging Het
Rnase9 T C 14: 51,039,080 N147S probably benign Het
Rnls C T 19: 33,382,381 G11D probably damaging Het
Sbf2 T C 7: 110,330,615 T333A probably damaging Het
Scn3a A T 2: 65,508,618 N572K probably damaging Het
Serinc3 A G 2: 163,627,971 L319P probably benign Het
Setbp1 T C 18: 78,857,839 D871G probably damaging Het
Sf3b2 T C 19: 5,279,895 T661A probably benign Het
Sgsm2 T A 11: 74,892,041 R30W probably damaging Het
Sh3tc1 A G 5: 35,723,944 S52P probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Snrpa A T 7: 27,192,964 M57K probably damaging Het
Srbd1 A T 17: 85,985,222 I973N probably damaging Het
Srp72 T A 5: 76,994,876 S428T probably benign Het
Ss18l2 A G 9: 121,712,605 Y50C probably damaging Het
St14 A G 9: 31,096,549 L578P probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Tmc1 T C 19: 20,824,283 N460D probably benign Het
Tnni3k C T 3: 154,961,864 G280R probably damaging Het
Trpc3 A G 3: 36,655,016 probably null Het
Tshr C T 12: 91,533,957 A152V probably damaging Het
Tuft1 G A 3: 94,614,154 P358S probably damaging Het
Vmn2r120 A T 17: 57,509,340 S672T probably damaging Het
Vmn2r83 G T 10: 79,480,259 E496D probably benign Het
Vmn2r91 A G 17: 18,136,009 N646S probably benign Het
Zfp9 A G 6: 118,464,465 V412A possibly damaging Het
Zmynd8 G T 2: 165,833,415 H273N probably damaging Het
Other mutations in Adcy9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Adcy9 APN 16 4304582 missense probably benign
IGL00326:Adcy9 APN 16 4294696 missense probably benign
IGL00792:Adcy9 APN 16 4288539 missense probably damaging 1.00
IGL01610:Adcy9 APN 16 4418114 missense probably damaging 1.00
IGL02376:Adcy9 APN 16 4418680 missense probably benign 0.01
IGL02424:Adcy9 APN 16 4288597 missense probably damaging 1.00
IGL03097:Adcy9 UTSW 16 4418066 missense possibly damaging 0.94
PIT4243001:Adcy9 UTSW 16 4418407 missense probably damaging 1.00
R0043:Adcy9 UTSW 16 4289015 missense probably benign 0.12
R0085:Adcy9 UTSW 16 4288224 missense probably benign
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0105:Adcy9 UTSW 16 4288388 missense probably damaging 1.00
R0371:Adcy9 UTSW 16 4288047 missense probably benign 0.06
R0613:Adcy9 UTSW 16 4419539 missense probably damaging 1.00
R0689:Adcy9 UTSW 16 4312804 splice site probably benign
R0744:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R0836:Adcy9 UTSW 16 4419271 missense possibly damaging 0.69
R1223:Adcy9 UTSW 16 4298748 missense probably damaging 1.00
R1251:Adcy9 UTSW 16 4311531 missense probably damaging 0.99
R1689:Adcy9 UTSW 16 4297562 splice site probably null
R1922:Adcy9 UTSW 16 4311657 missense probably damaging 1.00
R1955:Adcy9 UTSW 16 4418659 missense possibly damaging 0.63
R1989:Adcy9 UTSW 16 4298727 missense probably damaging 1.00
R1998:Adcy9 UTSW 16 4297412 missense probably benign 0.00
R2321:Adcy9 UTSW 16 4288268 missense probably damaging 1.00
R3160:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3161:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3162:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R3162:Adcy9 UTSW 16 4311588 missense probably damaging 1.00
R4065:Adcy9 UTSW 16 4288434 missense probably damaging 1.00
R4909:Adcy9 UTSW 16 4298754 missense probably benign 0.03
R5078:Adcy9 UTSW 16 4323907 missense probably benign 0.00
R5870:Adcy9 UTSW 16 4418368 missense probably damaging 1.00
R5968:Adcy9 UTSW 16 4298742 missense probably damaging 1.00
R5975:Adcy9 UTSW 16 4311567 missense probably damaging 0.98
R6014:Adcy9 UTSW 16 4418819 missense probably damaging 1.00
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6035:Adcy9 UTSW 16 4304513 missense probably benign
R6081:Adcy9 UTSW 16 4294681 missense probably benign
R6192:Adcy9 UTSW 16 4287954 missense probably benign
R6604:Adcy9 UTSW 16 4304407 missense probably damaging 0.98
R6739:Adcy9 UTSW 16 4418794 missense probably benign
R6829:Adcy9 UTSW 16 4307154 critical splice donor site probably null
R7491:Adcy9 UTSW 16 4418809 missense possibly damaging 0.51
R7561:Adcy9 UTSW 16 4418164 missense probably damaging 1.00
X0023:Adcy9 UTSW 16 4323916 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAGCTGTCTTCTGACTTCCAATG -3'
(R):5'- TCTGTCTTGAGGCAGGCTTC -3'

Sequencing Primer
(F):5'- TCACATGTAGGGACACAAACATG -3'
(R):5'- GCTTCTGGAGGACCCAACTC -3'
Posted On2018-11-28