Incidental Mutation 'R6994:Pikfyve'
ID544013
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Namephosphoinositide kinase, FYVE type zinc finger containing
SynonymsPip5k3
MMRRC Submission
Accession Numbers

Genbank: NM_011086

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6994 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location65186683-65278695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65252530 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 1303 (P1303T)
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]
Predicted Effect probably damaging
Transcript: ENSMUST00000081154
AA Change: P1258T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: P1258T

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097707
AA Change: P1303T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: P1303T

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (82/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 T G 4: 144,623,279 W369G probably damaging Het
Abhd16b C T 2: 181,493,668 T121M possibly damaging Het
Adam5 A T 8: 24,786,246 C468* probably null Het
Aim2 C T 1: 173,455,586 A78V possibly damaging Het
Alg9 G A 9: 50,792,122 W254* probably null Het
Ankrd55 G C 13: 112,368,300 E499Q probably benign Het
Atp6v0a2 T C 5: 124,714,145 F546S probably damaging Het
Bean1 CT C 8: 104,182,032 probably null Het
Bpi A T 2: 158,258,244 probably benign Het
Bves A G 10: 45,339,418 H63R probably benign Het
Ccdc183 T C 2: 25,617,045 M45V probably benign Het
Cmklr1 T C 5: 113,614,922 Y6C probably damaging Het
Colgalt1 C T 8: 71,623,521 R539C probably damaging Het
Ctsm T A 13: 61,539,884 E53D probably damaging Het
Cyp2a22 A G 7: 26,939,181 probably null Het
Ddx10 A G 9: 53,204,111 V641A probably damaging Het
Ddx6 T C 9: 44,628,723 V316A probably damaging Het
Dhx34 T C 7: 16,203,874 D767G probably benign Het
Dtnbp1 T A 13: 45,001,929 D15V probably damaging Het
Dtx3l C T 16: 35,931,372 probably null Het
Entpd8 T C 2: 25,083,309 I162T probably damaging Het
Fam186a G T 15: 99,942,466 Q1966K probably benign Het
Fbxo27 A C 7: 28,693,360 D22A probably damaging Het
Fermt3 A T 19: 6,999,727 I577N probably damaging Het
Frmd8 A T 19: 5,873,181 S81T probably damaging Het
Gm4788 T A 1: 139,736,930 I464L possibly damaging Het
Gm5108 T A 5: 67,944,669 probably benign Het
Gm9195 T C 14: 72,480,831 Y135C probably damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
H2afy T C 13: 56,089,830 N206D probably benign Het
Kcnh8 A T 17: 52,977,695 I898F probably benign Het
Kri1 C T 9: 21,287,787 probably benign Het
Krt32 T A 11: 100,086,445 I210F probably damaging Het
Lama1 G A 17: 67,753,825 C716Y Het
Lamc2 G A 1: 153,136,762 T722M probably benign Het
Lpin3 C T 2: 160,904,883 P766L probably damaging Het
Marf1 T C 16: 14,128,857 T1169A probably damaging Het
Morc1 G A 16: 48,565,621 V536M probably benign Het
Morc1 A T 16: 48,618,546 H768L probably benign Het
Mpped2 T A 2: 106,699,533 H42Q possibly damaging Het
Nfatc1 G T 18: 80,653,564 probably null Het
Nfkbid G A 7: 30,425,767 S263N probably benign Het
Npas3 C A 12: 54,068,793 Q802K probably damaging Het
Olfr202 T G 16: 59,284,090 M136L possibly damaging Het
Olfr492 T A 7: 108,322,894 I261F possibly damaging Het
Olfr591 T C 7: 103,172,912 T242A probably damaging Het
Pabpc4l C A 3: 46,446,910 V100L possibly damaging Het
Pagr1a A G 7: 127,016,441 probably null Het
Pcdh1 A T 18: 38,198,500 N483K probably damaging Het
Pih1d3 T C 1: 31,222,909 probably benign Het
Plekhh3 T A 11: 101,165,693 probably null Het
Pnkd T A 1: 74,293,176 probably null Het
Pparg A T 6: 115,451,050 Q166L probably benign Het
Psenen A G 7: 30,563,507 probably null Het
Rab4a T C 8: 123,830,366 S142P probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Relt A C 7: 100,853,114 probably benign Het
Rftn1 T A 17: 50,036,991 T90S possibly damaging Het
Ripor3 T G 2: 167,997,266 D105A probably damaging Het
Rnase10 T A 14: 51,009,681 I135N probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rttn A G 18: 89,028,899 E895G probably damaging Het
Serpina3a G A 12: 104,112,830 probably null Het
Slco5a1 C T 1: 12,881,393 C562Y probably damaging Het
Spen T C 4: 141,493,459 T396A unknown Het
Tgfbr3 A G 5: 107,133,026 S623P probably damaging Het
Tmem8b A G 4: 43,690,192 I876V probably damaging Het
Tmod3 T C 9: 75,509,387 K221R probably damaging Het
Tomm40 G T 7: 19,702,906 D40E probably damaging Het
Trav6d-4 G T 14: 52,753,591 G28V probably damaging Het
Trav8d-2 G T 14: 53,042,476 A17S probably benign Het
Triml2 T C 8: 43,190,078 C158R possibly damaging Het
Trip10 A G 17: 57,255,331 E283G probably damaging Het
Tubb2b T C 13: 34,127,535 Y425C probably damaging Het
Ubr1 T C 2: 120,963,593 T37A probably benign Het
Unc13b A G 4: 43,171,403 probably benign Het
Unc13b A G 4: 43,173,203 probably benign Het
Vcan A T 13: 89,693,407 D379E possibly damaging Het
Vmn1r44 T A 6: 89,894,158 H295Q probably benign Het
Vmn2r16 A T 5: 109,340,103 S281C probably damaging Het
Vmn2r84 C T 10: 130,391,007 A321T possibly damaging Het
Vsig10l A T 7: 43,465,067 H271L possibly damaging Het
Vwa8 A T 14: 78,908,156 H91L possibly damaging Het
Zfp957 T A 14: 79,213,690 E223V probably damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65260121 critical splice donor site probably null
IGL01135:Pikfyve APN 1 65251635 missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65258869 nonsense probably null
IGL01759:Pikfyve APN 1 65253353 missense probably benign 0.06
IGL01888:Pikfyve APN 1 65223640 missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65264365 missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65238544 critical splice donor site probably null
IGL02119:Pikfyve APN 1 65272571 missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65246397 missense probably benign 0.13
IGL02207:Pikfyve APN 1 65251678 critical splice donor site probably null
IGL02380:Pikfyve APN 1 65256021 missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65252569 missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65244504 missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65251612 missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65264376 missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65230855 critical splice donor site probably null
IGL02746:Pikfyve APN 1 65234272 missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65250194 nonsense probably null
IGL02890:Pikfyve APN 1 65230797 missense probably benign 0.00
IGL03102:Pikfyve APN 1 65252467 nonsense probably null
IGL03294:Pikfyve APN 1 65247067 missense probably damaging 1.00
falcon UTSW 1 65196741 missense probably damaging 1.00
oompa UTSW 1 65196706 missense probably damaging 1.00
wonka UTSW 1 65196706 missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65202916 missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65215929 splice site probably benign
R0196:Pikfyve UTSW 1 65256072 missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65262905 missense probably benign 0.41
R0319:Pikfyve UTSW 1 65246331 missense probably benign 0.01
R0332:Pikfyve UTSW 1 65264399 missense probably benign 0.02
R0389:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65196706 missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65219899 missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65253523 missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65253397 missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65265824 missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65246959 missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65202830 missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65271311 missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65251666 missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65224201 missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65262977 critical splice donor site probably null
R1501:Pikfyve UTSW 1 65265284 missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65252548 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65192271 missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65246370 missense probably benign
R1795:Pikfyve UTSW 1 65252557 missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65258798 missense probably benign 0.03
R1905:Pikfyve UTSW 1 65192295 critical splice donor site probably null
R1995:Pikfyve UTSW 1 65246708 missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65222357 missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65253353 missense probably benign 0.06
R2229:Pikfyve UTSW 1 65267855 missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65246676 missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65253517 missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65245758 missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65244420 missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65230845 missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65196681 missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65190520 unclassified probably benign
R4542:Pikfyve UTSW 1 65244430 missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65192192 missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65234262 missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65250273 missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65267846 missense probably benign
R4716:Pikfyve UTSW 1 65246476 missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65272515 missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65267846 missense probably benign
R4785:Pikfyve UTSW 1 65267846 missense probably benign
R4805:Pikfyve UTSW 1 65268800 missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65196741 missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65246590 missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65224117 intron probably benign
R5265:Pikfyve UTSW 1 65267829 missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65196699 nonsense probably null
R5384:Pikfyve UTSW 1 65244409 missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65265268 missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65235033 missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65252495 missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65253407 missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65273730 missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65256088 missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65216028 missense probably benign 0.09
R5891:Pikfyve UTSW 1 65202737 missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65253438 nonsense probably null
R6026:Pikfyve UTSW 1 65272697 missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65272571 missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65264345 critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65216043 missense probably benign 0.36
R6287:Pikfyve UTSW 1 65253532 critical splice donor site probably null
R6290:Pikfyve UTSW 1 65202925 critical splice donor site probably null
R6296:Pikfyve UTSW 1 65262953 missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65265781 missense probably benign 0.35
R6835:Pikfyve UTSW 1 65258843 missense probably damaging 0.98
R6997:Pikfyve UTSW 1 65246663 missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65234361 missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65246854 missense probably benign 0.01
R7057:Pikfyve UTSW 1 65247205 missense probably benign 0.00
R7525:Pikfyve UTSW 1 65244426 nonsense probably null
R7558:Pikfyve UTSW 1 65272623 missense probably benign 0.01
R7625:Pikfyve UTSW 1 65267877 missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65269942 missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65255134 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTATTCTAGAGCTGCTGCCG -3'
(R):5'- TAGCACAAGGTTATACGAAGATCAC -3'

Sequencing Primer
(F):5'- AGAGCTGCTGCCGTACTTTC -3'
(R):5'- AGGTTATACGAAGATCACAACAAC -3'
Posted On2019-05-13