Incidental Mutation 'PIT4514001:Vmn2r124'
Institutional Source Beutler Lab
Gene Symbol Vmn2r124
Ensembl Gene ENSMUSG00000094396
Gene Namevomeronasal 2, receptor 124
SynonymsGm7196, Vmn2r-ps113
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #PIT4514001 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location18049424-18079732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18073712 bp
Amino Acid Change Isoleucine to Threonine at position 687 (I687T)
Ref Sequence ENSEMBL: ENSMUSP00000135613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176802] [ENSMUST00000231546]
Predicted Effect probably benign
Transcript: ENSMUST00000176802
AA Change: I687T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135613
Gene: ENSMUSG00000094396
AA Change: I687T

signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 84 449 2.2e-37 PFAM
Pfam:NCD3G 510 563 9.3e-21 PFAM
Pfam:7tm_3 596 831 1.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231546
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.6%
  • 10x: 84.2%
  • 20x: 70.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,801,871 H221Q probably benign Het
1700023F06Rik T C 11: 103,201,134 D27G probably benign Het
4930486L24Rik A G 13: 60,853,514 probably null Het
Abcc10 T A 17: 46,305,648 I1247F probably benign Het
Acap3 G A 4: 155,903,378 A524T probably benign Het
Adcy10 T A 1: 165,556,791 N1040K probably benign Het
Adrb2 T C 18: 62,179,727 D9G probably benign Het
Aldh1a7 T C 19: 20,702,240 T391A probably benign Het
Bcam A G 7: 19,764,066 V344A probably benign Het
Birc7 T A 2: 180,931,306 I172N possibly damaging Het
Cfap126 G A 1: 171,125,312 D45N probably damaging Het
Cit G A 5: 115,997,854 probably null Het
Col26a1 A G 5: 136,751,725 V295A probably benign Het
Epha7 C T 4: 28,961,355 Q867* probably null Het
Fn1 A G 1: 71,628,456 S793P probably benign Het
Foxb1 T A 9: 69,760,221 Y9F probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gpc1 T A 1: 92,857,557 M406K probably benign Het
Gsg1 T C 6: 135,237,576 T312A probably benign Het
Hmcn1 T A 1: 150,669,487 I2790F possibly damaging Het
Kcnma1 C T 14: 23,309,035 probably null Het
Lmntd1 AGACTGTAAGTTTCTCAAATGTGTACCTGGA AGA 6: 145,427,253 probably null Het
Mcph1 A G 8: 18,631,890 K348E probably damaging Het
Olfr122 T A 17: 37,771,867 N71K probably damaging Het
Olfr985 T C 9: 40,127,299 I221V probably damaging Het
Pik3cg T A 12: 32,204,903 R362W probably damaging Het
Pkp3 T C 7: 141,089,710 L765P probably damaging Het
Plxna2 A T 1: 194,794,937 I1252F probably benign Het
Prpf8 T C 11: 75,496,355 F1154S possibly damaging Het
Scn7a A G 2: 66,684,179 F1084L probably damaging Het
Shmt1 G A 11: 60,804,347 S47L probably damaging Het
Snap91 T C 9: 86,879,433 K40R possibly damaging Het
Spag17 A T 3: 100,013,211 T421S possibly damaging Het
Speer4f1 T A 5: 17,478,756 N139K possibly damaging Het
Syne2 T G 12: 76,105,015 N1883K probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Tmem39b A C 4: 129,684,497 N310K possibly damaging Het
Trim3 T C 7: 105,618,210 T321A probably benign Het
Zbtb8a T C 4: 129,357,730 D316G probably benign Het
Zfp639 A G 3: 32,520,260 I345V possibly damaging Het
Zfp764 T C 7: 127,404,741 H406R probably benign Het
Other mutations in Vmn2r124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Vmn2r124 APN 17 18062670 missense probably benign 0.04
IGL01356:Vmn2r124 APN 17 18073471 missense probably benign 0.08
IGL01387:Vmn2r124 APN 17 18062926 missense probably damaging 0.98
IGL01413:Vmn2r124 APN 17 18062565 missense probably benign 0.41
IGL01550:Vmn2r124 APN 17 18063355 critical splice donor site probably null
IGL01759:Vmn2r124 APN 17 18064068 missense probably benign 0.00
IGL01762:Vmn2r124 APN 17 18063172 missense possibly damaging 0.51
IGL02132:Vmn2r124 APN 17 18064229 splice site probably benign
IGL02290:Vmn2r124 APN 17 18073335 missense probably benign 0.09
IGL02370:Vmn2r124 APN 17 18064191 missense probably benign 0.14
IGL02527:Vmn2r124 APN 17 18066502 critical splice acceptor site probably null
PIT4280001:Vmn2r124 UTSW 17 18063225 missense probably benign 0.22
R0362:Vmn2r124 UTSW 17 18064224 critical splice donor site probably null
R0401:Vmn2r124 UTSW 17 18064145 missense probably damaging 0.99
R0513:Vmn2r124 UTSW 17 18073729 missense possibly damaging 0.89
R1139:Vmn2r124 UTSW 17 18073790 missense possibly damaging 0.56
R1513:Vmn2r124 UTSW 17 18063273 missense probably damaging 1.00
R1669:Vmn2r124 UTSW 17 18062944 missense possibly damaging 0.94
R1710:Vmn2r124 UTSW 17 18061925 splice site probably benign
R1852:Vmn2r124 UTSW 17 18063174 missense probably benign
R1860:Vmn2r124 UTSW 17 18049497 missense probably benign 0.11
R1953:Vmn2r124 UTSW 17 18062860 missense probably benign 0.08
R2233:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2234:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2235:Vmn2r124 UTSW 17 18049665 missense possibly damaging 0.95
R2397:Vmn2r124 UTSW 17 18049597 missense possibly damaging 0.95
R2519:Vmn2r124 UTSW 17 18074018 missense probably damaging 1.00
R3845:Vmn2r124 UTSW 17 18073691 missense possibly damaging 0.90
R3846:Vmn2r124 UTSW 17 18073691 missense possibly damaging 0.90
R4594:Vmn2r124 UTSW 17 18073969 missense probably damaging 1.00
R4612:Vmn2r124 UTSW 17 18063022 missense probably benign 0.12
R4790:Vmn2r124 UTSW 17 18049593 missense probably damaging 1.00
R4809:Vmn2r124 UTSW 17 18073745 missense probably benign 0.00
R5227:Vmn2r124 UTSW 17 18049557 missense possibly damaging 0.95
R5254:Vmn2r124 UTSW 17 18063077 missense probably benign 0.00
R5609:Vmn2r124 UTSW 17 18073840 missense probably benign
R6145:Vmn2r124 UTSW 17 18062851 missense probably benign 0.05
R6181:Vmn2r124 UTSW 17 18073757 missense possibly damaging 0.93
R6271:Vmn2r124 UTSW 17 18062883 missense probably benign 0.01
R7297:Vmn2r124 UTSW 17 18073573 missense probably damaging 1.00
R7397:Vmn2r124 UTSW 17 18062685 missense probably damaging 1.00
R7406:Vmn2r124 UTSW 17 18062044 missense unknown
R7859:Vmn2r124 UTSW 17 18061950 missense probably damaging 1.00
R7942:Vmn2r124 UTSW 17 18061950 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-06-07