Incidental Mutation 'PIT4151001:Adam20'
ID557033
Institutional Source Beutler Lab
Gene Symbol Adam20
Ensembl Gene ENSMUSG00000046282
Gene Namea disintegrin and metallopeptidase domain 20
Synonyms4930529F22Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4151001 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location40793273-40797303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40795044 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 64 (V64I)
Ref Sequence ENSEMBL: ENSMUSP00000057794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056331]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056331
AA Change: V64I

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000057794
Gene: ENSMUSG00000046282
AA Change: V64I

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 51 177 1.3e-19 PFAM
Pfam:Reprolysin_5 219 399 5.4e-16 PFAM
Pfam:Reprolysin_4 219 408 5.4e-11 PFAM
Pfam:Reprolysin 221 411 3.1e-45 PFAM
Pfam:Reprolysin_3 248 366 2.5e-13 PFAM
Pfam:Reprolysin_2 295 403 1e-14 PFAM
DISIN 429 504 4.29e-33 SMART
ACR 505 641 3.9e-74 SMART
transmembrane domain 703 722 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.4%
  • 10x: 84.6%
  • 20x: 72.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,137,021 L1389P probably damaging Het
Acot10 C T 15: 20,666,598 G19D probably damaging Het
Ak6 T A 13: 100,655,095 D15E probably damaging Het
Atp1a2 A G 1: 172,290,721 Y129H probably damaging Het
Caskin1 C T 17: 24,502,219 T511I probably damaging Het
Casp9 C T 4: 141,793,948 R32* probably null Het
Ccdc40 A G 11: 119,242,451 E445G probably damaging Het
Cct8 T C 16: 87,487,657 E273G probably damaging Het
Chd5 G A 4: 152,378,529 V1380I probably damaging Het
Coro2b C T 9: 62,429,004 G272D probably damaging Het
Cyp4a10 C A 4: 115,524,875 H251Q probably damaging Het
Dgki A T 6: 37,063,981 H298Q probably benign Het
Dnmt3b T G 2: 153,684,479 probably null Het
Dzip1 A G 14: 118,922,788 F3L probably damaging Het
Egf A G 3: 129,702,549 S807P probably benign Het
Emc10 C T 7: 44,493,203 R105H Het
Enthd1 T C 15: 80,452,736 E499G probably damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Fer1l5 T A 1: 36,411,647 M1242K probably benign Het
Gm13083 T A 4: 143,616,152 C276* probably null Het
Gm3415 A G 5: 146,556,269 R36G probably benign Het
Gm5797 C A 14: 7,330,318 M114I possibly damaging Het
Gmppa A T 1: 75,441,824 R284* probably null Het
Homer1 G C 13: 93,349,216 K118N probably damaging Het
Ivl TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 3: 92,572,301 probably benign Het
Kcnc4 G A 3: 107,458,703 A63V probably damaging Het
Kif11 T A 19: 37,384,597 I88N probably damaging Het
Krba1 T C 6: 48,402,897 F9S probably damaging Het
Nckap1 A G 2: 80,520,370 probably null Het
Nox4 A T 7: 87,304,889 Y134F probably benign Het
Olfr1026 T A 2: 85,924,042 M258K probably damaging Het
Olfr1031 T C 2: 85,992,194 C126R probably damaging Het
Olfr1054 G T 2: 86,332,829 H176N possibly damaging Het
Olfr1252 T A 2: 89,721,893 T73S probably benign Het
Olfr562-ps1 T C 7: 102,782,258 S261P probably benign Het
Olfr672 A G 7: 104,996,217 L229P probably damaging Het
Pcdh17 G T 14: 84,447,358 V422L probably benign Het
Pcx T A 19: 4,603,129 V275E probably damaging Het
Pde6h A T 6: 136,961,187 M53L possibly damaging Het
Phactr3 A T 2: 178,334,068 E535D probably damaging Het
Pkn3 C A 2: 30,090,527 T810N probably damaging Het
Pnpla5 T C 15: 84,118,626 E252G probably damaging Het
Psg17 A G 7: 18,814,605 S414P probably benign Het
Pzp T A 6: 128,525,296 Q30L probably benign Het
Reln A T 5: 22,286,896 F113I possibly damaging Het
Ret T C 6: 118,164,741 D975G probably benign Het
Sarnp A G 10: 128,877,366 I209V probably benign Het
Sorl1 A T 9: 41,968,622 V2210D probably damaging Het
Stard9 C T 2: 120,702,756 Q3165* probably null Het
Tmem64 A T 4: 15,283,159 I319F probably damaging Het
Vmn1r176 A T 7: 23,835,383 V115D probably damaging Het
Vmn1r2 A G 4: 3,172,623 T181A probably benign Het
Vmn2r2 T C 3: 64,116,913 E749G possibly damaging Het
Vps35 G A 8: 85,284,048 T222I possibly damaging Het
Zfp532 A G 18: 65,624,414 T473A probably damaging Het
Zfyve16 A G 13: 92,521,204 V733A probably damaging Het
Zranb1 T A 7: 132,949,994 S125T probably benign Het
Other mutations in Adam20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Adam20 APN 8 40796047 missense probably benign 0.00
IGL01357:Adam20 APN 8 40796560 missense probably benign 0.09
IGL01877:Adam20 APN 8 40795945 missense probably benign 0.00
IGL02295:Adam20 APN 8 40796836 missense probably damaging 1.00
IGL02683:Adam20 APN 8 40795584 missense probably damaging 0.98
IGL03090:Adam20 APN 8 40794928 missense probably benign 0.00
BB007:Adam20 UTSW 8 40797070 missense probably benign 0.00
BB017:Adam20 UTSW 8 40797070 missense probably benign 0.00
PIT4696001:Adam20 UTSW 8 40794948 missense probably benign 0.20
R0607:Adam20 UTSW 8 40795480 missense probably benign 0.02
R0885:Adam20 UTSW 8 40796558 missense probably benign 0.02
R1018:Adam20 UTSW 8 40796109 nonsense probably null
R1147:Adam20 UTSW 8 40795618 missense possibly damaging 0.82
R1147:Adam20 UTSW 8 40795618 missense possibly damaging 0.82
R1421:Adam20 UTSW 8 40796747 missense possibly damaging 0.48
R1739:Adam20 UTSW 8 40796558 missense probably benign 0.02
R1778:Adam20 UTSW 8 40796661 missense possibly damaging 0.92
R1844:Adam20 UTSW 8 40796043 missense probably benign
R3814:Adam20 UTSW 8 40795675 missense probably damaging 1.00
R3877:Adam20 UTSW 8 40796634 missense possibly damaging 0.75
R4193:Adam20 UTSW 8 40795315 missense probably damaging 0.99
R4357:Adam20 UTSW 8 40795047 missense possibly damaging 0.61
R4846:Adam20 UTSW 8 40795011 missense probably benign 0.10
R5452:Adam20 UTSW 8 40795764 missense probably damaging 0.96
R6559:Adam20 UTSW 8 40796292 missense probably benign 0.03
R6708:Adam20 UTSW 8 40796494 missense probably damaging 1.00
R6730:Adam20 UTSW 8 40796659 missense probably benign 0.23
R7194:Adam20 UTSW 8 40796412 missense probably benign 0.45
R7323:Adam20 UTSW 8 40795384 missense probably benign 0.45
R7917:Adam20 UTSW 8 40796371 missense probably damaging 1.00
R7930:Adam20 UTSW 8 40797070 missense probably benign 0.00
R7954:Adam20 UTSW 8 40796544 missense probably damaging 1.00
R7964:Adam20 UTSW 8 40796907 missense probably damaging 0.97
R8006:Adam20 UTSW 8 40795907 missense probably benign 0.02
R8125:Adam20 UTSW 8 40794936 missense probably benign 0.01
R8134:Adam20 UTSW 8 40796064 missense probably benign 0.02
R8435:Adam20 UTSW 8 40795035 missense probably damaging 1.00
R8530:Adam20 UTSW 8 40796034 missense probably damaging 1.00
R8695:Adam20 UTSW 8 40795828 missense probably benign 0.13
R8757:Adam20 UTSW 8 40795906 missense probably benign 0.00
R8871:Adam20 UTSW 8 40795564 missense probably damaging 0.98
R8935:Adam20 UTSW 8 40794952 missense probably benign 0.00
X0062:Adam20 UTSW 8 40797024 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATTAAAAGCCAGCACTGCATG -3'
(R):5'- GGCCATGGTAGTAGCAATCATTC -3'

Sequencing Primer
(F):5'- AACACAAAGGGCATCCTCCTTTG -3'
(R):5'- ATCATTCTGGACATAAGGCTGGTCC -3'
Posted On2019-06-07