Incidental Mutation 'R6985:Ctsh'
ID557094
Institutional Source Beutler Lab
Gene Symbol Ctsh
Ensembl Gene ENSMUSG00000032359
Gene Namecathepsin H
SynonymsCat H
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6985 (G1)
Quality Score64.0073
Status Validated
Chromosome9
Chromosomal Location90054152-90076089 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90054604 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 19 (A19T)
Ref Sequence ENSEMBL: ENSMUSP00000122108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034915] [ENSMUST00000123320] [ENSMUST00000132718] [ENSMUST00000143172] [ENSMUST00000185459]
Predicted Effect probably benign
Transcript: ENSMUST00000034915
AA Change: A19T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034915
Gene: ENSMUSG00000032359
AA Change: A19T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Inhibitor_I29 33 88 7.24e-17 SMART
Pept_C1 114 330 7.46e-108 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123320
AA Change: A19T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000132718
AA Change: A45T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000117599
Gene: ENSMUSG00000032359
AA Change: A45T

DomainStartEndE-ValueType
Inhibitor_I29 59 114 7.24e-17 SMART
Pfam:Peptidase_C1 140 198 4.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143172
AA Change: A19T

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114427
Gene: ENSMUSG00000032359
AA Change: A19T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1cs8a_ 62 118 3e-6 SMART
Blast:Pept_C1 63 119 3e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185459
AA Change: A16T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140437
Gene: ENSMUSG00000032359
AA Change: A16T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Inhibitor_I29 30 85 5.3e-21 SMART
Pept_C1 85 291 9.4e-87 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the cathepsin H mini, heavy, and light chains. In rat and human, these three chains can associate to form the mature enzyme, which has both aminopeptidase and endopeptidase activities. Homozygous knockout mice for this gene exhibit impaired lung surfactant processing and reduced tumorigenesis in a pancreatic cancer model. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit impaired lung surfactant and an abnormal eye globe with elongated axial length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin1 A G 4: 123,736,856 *192R probably null Het
Ankar A C 1: 72,658,482 L836R probably damaging Het
Anxa7 G T 14: 20,471,568 A20E unknown Het
Arhgap1 T A 2: 91,668,198 Y147N probably damaging Het
Arid2 T C 15: 96,370,148 V714A probably benign Het
Arrdc3 T C 13: 80,883,657 L3P probably damaging Het
Bhmt2 T C 13: 93,663,322 D202G possibly damaging Het
Bub1b A G 2: 118,606,614 R98G probably damaging Het
Capn10 T C 1: 92,943,424 Y319H probably damaging Het
Cep95 T C 11: 106,818,703 F115S probably damaging Het
Chsy3 A T 18: 59,176,488 probably null Het
Cnot1 T C 8: 95,734,129 N1755S probably benign Het
Cntn4 A G 6: 106,679,417 N893S probably benign Het
Cttn C A 7: 144,452,587 E214* probably null Het
Des A G 1: 75,366,787 E438G possibly damaging Het
Dnaja4 T C 9: 54,708,395 V109A probably benign Het
Dock1 A G 7: 135,163,403 E1708G possibly damaging Het
Dst T C 1: 34,190,853 I2184T probably benign Het
Enc1 C T 13: 97,245,120 T46I possibly damaging Het
Etaa1 A G 11: 17,946,108 S670P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fbn2 A T 18: 58,068,388 V1319E probably damaging Het
Fcrl1 T A 3: 87,389,650 V302E probably benign Het
Fgfr3 G C 5: 33,735,441 E744Q probably null Het
Gmps T A 3: 64,015,539 I641N probably damaging Het
Gpc2 T A 5: 138,278,408 Y152F probably damaging Het
Herc2 G A 7: 56,106,453 R747H possibly damaging Het
Herc2 A G 7: 56,132,480 D1305G probably damaging Het
Ighv1-37 T C 12: 114,896,632 T14A probably benign Het
Insr T A 8: 3,161,372 M1156L possibly damaging Het
Kirrel2 C A 7: 30,455,306 G127C probably damaging Het
Krt10 T C 11: 99,385,630 N65S possibly damaging Het
Lrig3 A G 10: 126,014,869 I1101M possibly damaging Het
Lrrc55 T G 2: 85,191,930 N306H probably benign Het
Map4k3 A G 17: 80,636,732 S329P probably damaging Het
Mapkap1 T G 2: 34,432,110 H13Q probably damaging Het
Mki67 A G 7: 135,713,865 L60S probably damaging Het
Muc4 A T 16: 32,751,999 M626L probably benign Het
Mycbp2 C T 14: 103,206,681 V1914I possibly damaging Het
Myo5b T C 18: 74,653,361 F442L possibly damaging Het
Naa35 T A 13: 59,627,943 M545K probably benign Het
Nrxn2 T A 19: 6,481,245 V645E probably damaging Het
Olfr313 T C 11: 58,817,113 F35S probably damaging Het
Olfr619 A G 7: 103,603,668 T5A probably benign Het
Otx1 A T 11: 21,996,615 Y231* probably null Het
Pcdhb19 A G 18: 37,497,158 E2G probably benign Het
Pik3c2a G A 7: 116,417,988 T178I probably damaging Het
Plxna4 A G 6: 32,237,708 S613P probably damaging Het
Pon1 T G 6: 5,168,345 D354A probably benign Het
Prtg T G 9: 72,851,501 I379S probably damaging Het
Rbm17 T G 2: 11,590,693 M234L probably benign Het
Rex1bd T C 8: 70,505,905 S71G probably benign Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Samd7 G C 3: 30,751,123 K18N probably benign Het
Shank1 A G 7: 44,344,913 I833V unknown Het
Slc35f1 C A 10: 53,021,911 D139E probably benign Het
Spata31d1a T C 13: 59,703,093 N407S probably benign Het
Spata31d1d T A 13: 59,731,615 I36F probably benign Het
Sstr4 T A 2: 148,396,249 M260K probably damaging Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ticam1 C T 17: 56,269,900 E732K probably benign Het
Trat1 A G 16: 48,754,271 Y55H probably damaging Het
Vcan T C 13: 89,679,956 T3124A probably damaging Het
Wdfy4 A T 14: 33,099,117 F1385Y possibly damaging Het
Xrcc3 T C 12: 111,812,096 D7G probably damaging Het
Other mutations in Ctsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Ctsh APN 9 90064238 missense probably damaging 1.00
IGL01875:Ctsh APN 9 90064207 missense probably damaging 1.00
IGL02008:Ctsh APN 9 90061547 missense probably damaging 1.00
R0336:Ctsh UTSW 9 90075738 missense probably damaging 1.00
R0632:Ctsh UTSW 9 90061582 missense possibly damaging 0.82
R1488:Ctsh UTSW 9 90071891 missense possibly damaging 0.89
R1847:Ctsh UTSW 9 90061565 missense probably benign 0.04
R3613:Ctsh UTSW 9 90075710 missense probably damaging 1.00
R4270:Ctsh UTSW 9 90061598 missense probably damaging 0.99
R4860:Ctsh UTSW 9 90054548 missense probably benign 0.01
R5187:Ctsh UTSW 9 90054590 missense probably damaging 1.00
R5469:Ctsh UTSW 9 90060511 critical splice donor site probably null
R5900:Ctsh UTSW 9 90064568 missense probably damaging 1.00
R5937:Ctsh UTSW 9 90061456 missense probably benign
R6303:Ctsh UTSW 9 90062743 missense possibly damaging 0.83
R6657:Ctsh UTSW 9 90060502 missense probably benign 0.30
R6905:Ctsh UTSW 9 90062766 missense probably damaging 1.00
R7171:Ctsh UTSW 9 90067101 missense probably benign
R7342:Ctsh UTSW 9 90074987 missense probably benign
R7819:Ctsh UTSW 9 90060503 missense possibly damaging 0.71
R7884:Ctsh UTSW 9 90061423 missense probably benign
R7967:Ctsh UTSW 9 90061423 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGGAGTGTAATGGCCAC -3'
(R):5'- AAAGTTTTGTGCCCTTAGCTGTC -3'

Sequencing Primer
(F):5'- TGTAATGGCCACAGGGGG -3'
(R):5'- AAGGCTTCTGTATCTAGATCTGAGCC -3'
Posted On2019-06-14